View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12515_low_25 (Length: 327)
Name: NF12515_low_25
Description: NF12515
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12515_low_25 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 188; Significance: 1e-102; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 188; E-Value: 1e-102
Query Start/End: Original strand, 18 - 209
Target Start/End: Complemental strand, 9058994 - 9058803
Alignment:
| Q |
18 |
gtttctacaggaaaatcactcagcttaaactactatgaaaaatcatgccatgatctggagtatatagttttgaagactgtgacagatgctactgctaggg |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
9058994 |
gtttctacaggaaaatcactcagcttaaactactatgaaaaatcatgccatgatctggagtatatagttttgaagactgtgacggatgctactgctaggg |
9058895 |
T |
|
| Q |
118 |
acaaaactgttccagcagcacttctccgaatgcacttccatgattgcttcgttcgagtattgctatattgaactcctttcttcttgacattg |
209 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9058894 |
acaaaactgttccagcagcacttctccgaatgcacttccatgattgcttcgttcgagtattgctatattgaactcctttcttcttgacattg |
9058803 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 83; E-Value: 3e-39
Query Start/End: Original strand, 236 - 322
Target Start/End: Complemental strand, 9058776 - 9058690
Alignment:
| Q |
236 |
ccgcacaccatctataaatttgattattcatttgcatgtgtcgttttttcctatacttttgaaggggtgtgatgcatctgtgctgct |
322 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9058776 |
ccgcacaccatctataaatttgatttttcatttgcatgtgtcgttttttcctatacttttgaaggggtgtgatgcatctgtgctgct |
9058690 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 36; Significance: 0.00000000003; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 117 - 172
Target Start/End: Original strand, 31747788 - 31747843
Alignment:
| Q |
117 |
gacaaaactgttccagcagcacttctccgaatgcacttccatgattgcttcgttcg |
172 |
Q |
| |
|
||||||||||| || ||||| ||||||||||||||||||||||| |||||| |||| |
|
|
| T |
31747788 |
gacaaaactgtccctgcagcgcttctccgaatgcacttccatgactgcttcattcg |
31747843 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University