View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF12515_low_40 (Length: 240)

Name: NF12515_low_40
Description: NF12515
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF12515_low_40
NF12515_low_40
[»] chr8 (1 HSPs)
chr8 (1-223)||(40626537-40626759)


Alignment Details
Target: chr8 (Bit Score: 151; Significance: 5e-80; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 151; E-Value: 5e-80
Query Start/End: Original strand, 1 - 223
Target Start/End: Original strand, 40626537 - 40626759
Alignment:
1 tgtttgctgatgatctgttatttctattgtactacttgtgaattatcactttgtcttttattaatgcatgaaggcaatggattatgaaccatcgtttaag 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||  ||||||||||||||||||||||||||||||||||||||||||||||||    
40626537 tgtttgctgatgatctgttatttctattgtactacttgtgaattatcact--gtcttttattaatgcatgaaggcaatggattatgaaccatcgtttaag 40626634  T
101 aaaatcatataagtgtgttgtgtga--annnnnnnngggagctactttcccaacgttttgtaaactagggaaatgctaacggatgtcttcaaaacactgt 198  Q
    |||||||||| |||||| |||||||           |||||||||||||||||||||||||||||||| |||||||||||| || ||||||||||| |||    
40626635 aaaatcatattagtgtgctgtgtgatttttttttttgggagctactttcccaacgttttgtaaactagagaaatgctaacgaatatcttcaaaacaatgt 40626734  T
199 ttactgtctaaaaatactttcgaac 223  Q
    |||||||||||||||||||||||||    
40626735 ttactgtctaaaaatactttcgaac 40626759  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University