View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF12515_low_44 (Length: 236)

Name: NF12515_low_44
Description: NF12515
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF12515_low_44
NF12515_low_44
[»] chr1 (1 HSPs)
chr1 (7-98)||(38014260-38014351)


Alignment Details
Target: chr1 (Bit Score: 72; Significance: 7e-33; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 72; E-Value: 7e-33
Query Start/End: Original strand, 7 - 98
Target Start/End: Complemental strand, 38014351 - 38014260
Alignment:
7 gtgttatgcttataagcaaccttgtatttgggttgtcgactagcaatttgaatatattctctgttttttgtggacaaattgtgagtatgttg 98  Q
    |||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |||||||||| | | ||||||||||||    
38014351 gtgttatgcttataagcaaccttgtatttgggttctcgactagcaatttgaatatattctctgtattttgtggactattcgtgagtatgttg 38014260  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University