View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12515_low_48 (Length: 208)
Name: NF12515_low_48
Description: NF12515
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12515_low_48 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 170; Significance: 2e-91; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 170; E-Value: 2e-91
Query Start/End: Original strand, 14 - 191
Target Start/End: Original strand, 45427908 - 45428085
Alignment:
| Q |
14 |
cagagatgtaaatcgaggtatagaattgaaagcatctagcatacccaaacaaaggaaaagttggcccaagtcctgcaaactaaattaacttgctggcacc |
113 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45427908 |
cagaaatgtaaatcgaggtatagaattgaaagcatctagcatacccaaacaaaggaaaagtaggcccaagtcctgcaaactaaattaacttgctggcacc |
45428007 |
T |
|
| Q |
114 |
agcattgcatgaaagcaaatatgaacagttgctgataccaggtatcatacaccatggaaatgaaccgatgtactcaat |
191 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45428008 |
agcattgcatgaaagcaaatatgaacagttgctgataccaggtatcatacaccatggaaatgaaccgatgtactcaat |
45428085 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University