View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12516_high_11 (Length: 247)
Name: NF12516_high_11
Description: NF12516
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12516_high_11 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 220; Significance: 1e-121; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 220; E-Value: 1e-121
Query Start/End: Original strand, 1 - 232
Target Start/End: Original strand, 2368735 - 2368966
Alignment:
| Q |
1 |
ttcaggtacacttgatcacatcccaattttttatagagtatactatatgatcatgaatgaatttggattattaatttattgttgtataaagggcgtggat |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2368735 |
ttcaggtacacttgatcacatcccaattttttatagagtatactatatgatcatgaatgaatttggattattaatttattgttgtataaagggcgtggat |
2368834 |
T |
 |
| Q |
101 |
ctggtataggaggattgatcgcaggggcggcagctgcatacggtgctcaccatctgtcttatggacatggaggttatcatcatggttatggttatggtta |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
2368835 |
ctggtataggaggattgatcgcaggggcggcagctgcatatggtgctcaccatctgtctcatggacatggaggttaccatcatggttatggttatggtta |
2368934 |
T |
 |
| Q |
201 |
tggacatgggaagtataagcatggcaaatttg |
232 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
2368935 |
tggacatgggaagtataagcatggcaaatttg |
2368966 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 101 - 191
Target Start/End: Original strand, 2365416 - 2365506
Alignment:
| Q |
101 |
ctggtataggaggattgatcgcaggggcggcagctgcatacggtgctcaccatctgtcttatggacatggaggttatcatcatggttatgg |
191 |
Q |
| |
|
|||||||||||||| || | ||||| | || |||||||||||| ||||||||||||| |||||||||||||||||||||||||| |||| |
|
|
| T |
2365416 |
ctggtataggaggactgtttgcaggaggggtggctgcatacggttctcaccatctgtcacatggacatggaggttatcatcatggtcatgg |
2365506 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University