View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12516_low_11 (Length: 254)
Name: NF12516_low_11
Description: NF12516
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12516_low_11 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 109; Significance: 6e-55; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 109; E-Value: 6e-55
Query Start/End: Original strand, 127 - 247
Target Start/End: Original strand, 10249760 - 10249880
Alignment:
| Q |
127 |
ttcctcttcgtgcgttgtggcttgctcacaacaatcttcaaccaaagatggttctgaaataagtttggaagctacatgaattttaaggttaaatgaataa |
226 |
Q |
| |
|
||||||||||||| ||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
10249760 |
ttcctcttcgtgcattgaggcttgctcacaacaatcttcaaccaaagatggttctgaaataagtttggaagctacatgaattttaaggtaaaatgaataa |
10249859 |
T |
 |
| Q |
227 |
gtttggaatattttcatctca |
247 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
10249860 |
gtttggaatattttcatctca |
10249880 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 77; E-Value: 8e-36
Query Start/End: Original strand, 40 - 124
Target Start/End: Original strand, 10249170 - 10249254
Alignment:
| Q |
40 |
tattgagatgatgagttgtgtagtagaaattaggcatggccatcatgatggattcattctactagattgttgcgatcaaatggtc |
124 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
10249170 |
tattgagatgatgagttgtgtagtagaaattaggtatggccatcatgatggattcattctactagattgttgcgatgaaatggtc |
10249254 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University