View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12516_low_14 (Length: 229)
Name: NF12516_low_14
Description: NF12516
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12516_low_14 |
 | |
|
| [»] chr1 (1 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 213; Significance: 1e-117; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 213; E-Value: 1e-117
Query Start/End: Original strand, 6 - 229
Target Start/End: Original strand, 6155642 - 6155866
Alignment:
| Q |
6 |
aaaaacaacctagaatctaatgcctatgaaatttaatctatgtctaatttgaaatgtggttgcagccgtccgctgcgcagaccatttcttgg-acttcag |
104 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
6155642 |
aaaaacaacctagaatctaatgcctatgaaatttaatctatgtctaatttgaaatgtggttgcagccgtccgctgcgcagaccatttcttgggacttcag |
6155741 |
T |
|
| Q |
105 |
gggtaactctgagaagctagtaattccagtgagacaacaatttcaccaatgagtggacgggattttggttcctcccggagacacatagcagtcatacaaa |
204 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6155742 |
gggtaactctgagaagctagtaattccagtgagacagcaatttcaccaatgagtggacgggattttggttcctcccggagacacatagcagtcatacaaa |
6155841 |
T |
|
| Q |
205 |
tcatccgatgcaaactgctgagggg |
229 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
6155842 |
tcatccgatgcaaactgctgagggg |
6155866 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 43; Significance: 0.000000000000001; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 110 - 196
Target Start/End: Original strand, 54031133 - 54031219
Alignment:
| Q |
110 |
actctgagaagctagtaattccagtgagacaacaatttcaccaatgagtggacgggattttggttcctcccggagacacatagcagt |
196 |
Q |
| |
|
|||||| |||||||| ||||||||| || ||||| |||||||||||||||||| ||||||||| ||| |||||||||||||||| |
|
|
| T |
54031133 |
actctgcgaagctaggtattccagtgctacgacaatatcaccaatgagtggacggaattttggttgctcttggagacacatagcagt |
54031219 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University