View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12516_low_7 (Length: 286)
Name: NF12516_low_7
Description: NF12516
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12516_low_7 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 126; Significance: 5e-65; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 126; E-Value: 5e-65
Query Start/End: Original strand, 136 - 273
Target Start/End: Complemental strand, 3098579 - 3098443
Alignment:
| Q |
136 |
tctagacggtgactgctttgtatttgcagctgctaaatgattgttggaaagcatttagaggtgaaattagtacacaatcaaatcttatctttacaaggaa |
235 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3098579 |
tctagacggtgactgctttgtatt-gcagctgctaaatgattgttggaaagcatttagaggtgaaattagtacacaatcaaatcttatctttacaaggaa |
3098481 |
T |
|
| Q |
236 |
gccatcctctttactcatgctatggacaaaatttgatg |
273 |
Q |
| |
|
|| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
3098480 |
gcgatcctctttactcatgctatggacaaaatttgatg |
3098443 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 75; E-Value: 1e-34
Query Start/End: Original strand, 136 - 248
Target Start/End: Complemental strand, 3092490 - 3092381
Alignment:
| Q |
136 |
tctagacggtgactgctttgtatttgcagctgctaaatgattgttggaaagcatttagaggtgaaattagtacacaatcaaatcttatctttacaaggaa |
235 |
Q |
| |
|
|||||| ||||| |||||||| ||||||||||||||||||||||||||||||||| ||| ||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
3092490 |
tctagatggtgattgctttgtttttgcagctgctaaatgattgttggaaagcattcagaagtgaa---agtacacaatcaaatcttatctttacaaggaa |
3092394 |
T |
|
| Q |
236 |
gccatcctcttta |
248 |
Q |
| |
|
|| |||||||||| |
|
|
| T |
3092393 |
gcgatcctcttta |
3092381 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University