View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12517_low_4 (Length: 391)
Name: NF12517_low_4
Description: NF12517
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12517_low_4 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 163; Significance: 6e-87; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 163; E-Value: 6e-87
Query Start/End: Original strand, 18 - 180
Target Start/End: Complemental strand, 10069586 - 10069424
Alignment:
| Q |
18 |
aatgttgcatgcaacatattctttacttttatgagttttaaactcttcgtctctctgctttggttcctattgttaaggtaacagaaaaagaaacttcatt |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10069586 |
aatgttgcatgcaacatattctttacttttatgagttttaaactcttcgtctctctgctttggttcctattgttaaggtaacagaaaaagaaacttcatt |
10069487 |
T |
|
| Q |
118 |
ttctcacttatctatcaaaaccaaccttggtggtgtttactgtttttccttttccttctacta |
180 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10069486 |
ttctcacttatctatcaaaaccaaccttggtggtgtttactgtttttccttttccttctacta |
10069424 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 104; E-Value: 9e-52
Query Start/End: Original strand, 225 - 381
Target Start/End: Complemental strand, 10069266 - 10069111
Alignment:
| Q |
225 |
attacaaacataaacaaaataaataatgaaattggataatgattttatagccatgcagcacttatagtcatacataaaatagcttaccnnnnnnnnctag |
324 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||| |||||||||||||||| |||||||||||||||||||||||||||||| |||| |
|
|
| T |
10069266 |
attacaaacataaacaacctaaataatgaaattggataatcattttatagccatgcaccacttatagtcatacataaaatagcttacc-tttttttctag |
10069168 |
T |
|
| Q |
325 |
ttatgtgtgaactcaaaaattctaatttcaagatggattttgcagggttgcagtgaa |
381 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| ||||| ||||||||| |
|
|
| T |
10069167 |
ttatgtgtgaactcaaaaattctaatttcaagatggatttttcagggatgcagtgaa |
10069111 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University