View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12518_high_1 (Length: 498)
Name: NF12518_high_1
Description: NF12518
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12518_high_1 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 314; Significance: 1e-177; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 314; E-Value: 1e-177
Query Start/End: Original strand, 167 - 492
Target Start/End: Complemental strand, 9234302 - 9233977
Alignment:
| Q |
167 |
ttttcaacttcgacatgcaaaatggtagacccgatcccaacaactagaaccattaatttaatctctctttttcaccaattccattcacacaccctccatt |
266 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
9234302 |
ttttcaacctcgacatgcaaaatggtagacccgatcccaacaactagaaccattaatttaatctctctttttcatcaattccattcacacaccctccatt |
9234203 |
T |
 |
| Q |
267 |
gttttaagcttcagatttctcaactggaacttcttctgctgctggagcttccactgactcaactggtttaacattctcttcctcagcagttactgctgct |
366 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9234202 |
gttttaagcttcagatttctcaactggaacttcttctgctgctggagcttccactgactcaactggtttaacattctcttcctcagcagttactgctgct |
9234103 |
T |
 |
| Q |
367 |
ggtgcttctgactcattttcaatggttgctacaggctcctccactactgctgcagcctcttccttcacttcttcaactgattcctctgtttctttaggtg |
466 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9234102 |
ggtgcttctgactcattttcaatggttgctacaggctcctccactactgctgcagcctcttccttcacttcttcaactgattcctctgtttctttaggtg |
9234003 |
T |
 |
| Q |
467 |
cttctgtattctcttcctttgcttct |
492 |
Q |
| |
|
||||||||||||||||||| |||||| |
|
|
| T |
9234002 |
cttctgtattctcttccttggcttct |
9233977 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 86; E-Value: 7e-41
Query Start/End: Original strand, 1 - 106
Target Start/End: Complemental strand, 9234468 - 9234363
Alignment:
| Q |
1 |
ccaccattcaacatgtatatatatgctgacatggagcaaagttccatacataactgatgtagatagttataccctccttatgaataaccatttccaaagc |
100 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |||||||||| ||||||||||||||||||||| |
|
|
| T |
9234468 |
ccaccattcagcatgtatatatatgctgacatggagtaaagttccatacataactgatgtagatagctataccctccatatgaataaccatttccaaaga |
9234369 |
T |
 |
| Q |
101 |
cttact |
106 |
Q |
| |
|
|||||| |
|
|
| T |
9234368 |
cttact |
9234363 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University