View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF12518_high_19 (Length: 224)

Name: NF12518_high_19
Description: NF12518
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF12518_high_19
NF12518_high_19
[»] chr6 (1 HSPs)
chr6 (13-209)||(34772125-34772321)
[»] chr5 (1 HSPs)
chr5 (121-197)||(9531851-9531926)


Alignment Details
Target: chr6 (Bit Score: 197; Significance: 1e-107; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 197; E-Value: 1e-107
Query Start/End: Original strand, 13 - 209
Target Start/End: Original strand, 34772125 - 34772321
Alignment:
13 tgaagaagaatagaatgaggtttgaagtttctttagatttgtgggaagctatgagtgaagatgaaaagttagtttggagggaccgtggagcaagaaattg 112  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
34772125 tgaagaagaatagaatgaggtttgaagtttctttagatttgtgggaagctatgagtgaagatgaaaagttagtttggagggaccgtggagcaagaaattg 34772224  T
113 ctttgaagcaagacttcatggatgggatgctctaggtacgacatccggagacatgaaagaaatgtattgcagactttctaatgcagttgatgttgct 209  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
34772225 ctttgaagcaagacttcatggatgggatgctctaggtacgacatccggagacatgaaagaaatgtattgcagactttctaatgcagttgatgttgct 34772321  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5 (Bit Score: 37; Significance: 0.000000000005; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 121 - 197
Target Start/End: Complemental strand, 9531926 - 9531851
Alignment:
121 caagacttcatggatgggatgctctaggtacgacatccggagacatgaaagaaatgtattgcagactttctaatgca 197  Q
    |||||| |||||||||||||| ||||||   |||||| | ||| |||||||||||||||||||| ||||||||||||    
9531926 caagacgtcatggatgggatgttctaggatggacatcag-agagatgaaagaaatgtattgcaggctttctaatgca 9531851  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University