View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12518_high_23 (Length: 201)
Name: NF12518_high_23
Description: NF12518
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12518_high_23 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 120; Significance: 1e-61; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 120; E-Value: 1e-61
Query Start/End: Original strand, 18 - 182
Target Start/End: Complemental strand, 42003830 - 42003656
Alignment:
| Q |
18 |
gaacgattaaatgtgttaagtaattcaactagtttgaactaataataaagagttgaaagaccagattcaaattatc----------aaatattaacctaa |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| ||||||||||||| |||||||||||||| |
|
|
| T |
42003830 |
gaacgattaaatgtgttaagtaattcaactggtttgaactaataataaagagttgaaagattagattcaaattatggtaaaatagaaaatattaacctaa |
42003731 |
T |
 |
| Q |
108 |
ccactacgtttcaaaacaaaaatcataactatcgatttaaatctagtctcgtaatcaattggtaggtggcaagac |
182 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
42003730 |
ccactacgtttcaaaacaaaaatcataactatcgatttaaatctagtctcgtaatcaattggtaagtggcaagac |
42003656 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University