View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12518_low_17 (Length: 343)
Name: NF12518_low_17
Description: NF12518
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12518_low_17 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 287; Significance: 1e-161; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 287; E-Value: 1e-161
Query Start/End: Original strand, 18 - 333
Target Start/End: Original strand, 32822218 - 32822533
Alignment:
| Q |
18 |
cctacaaaccaacattgccctcttctcatcaccactctcacaacctgaaacatccaaaacactactagctttgtcgtgtgctttcccactcgttgctgtc |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32822218 |
cctacaaaccaacattgccctcttctcatcaccactctcacaacctgaaacatccaaaacactactagctttgtcgtgtgctttcccactcgttgctgtc |
32822317 |
T |
|
| Q |
118 |
gtcaatatcccatcgccaccattcaacttaaacccgtgttttattatgccgcatacattgcattgtgatgttgagttgcagagatttgaggaaccgttta |
217 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32822318 |
gtcaatatcccatcgccaccattcaacttaaacccgtgttttattatgccgcacacattgcattgtgatgttgagttgcagagatttgaggaaccgttta |
32822417 |
T |
|
| Q |
218 |
ggcctaaagaacaaacaaagcttgtgcagtgaaaccttagtaactcgtttccgtctgctatgcagcggggatgnnnnnnngagagatttgttgcttttgc |
317 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
32822418 |
ggcctaaagaacaaacaaaggttgtgcagtgaaaccttagtaactcgtttccgtctgctatgcagcggggatgtttttttgagagatttgttgcttttgc |
32822517 |
T |
|
| Q |
318 |
tttgattgagtctctg |
333 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
32822518 |
tttgattgagtctctg |
32822533 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University