View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12518_low_25 (Length: 251)
Name: NF12518_low_25
Description: NF12518
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12518_low_25 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 209; Significance: 1e-114; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 209; E-Value: 1e-114
Query Start/End: Original strand, 19 - 239
Target Start/End: Original strand, 48089048 - 48089268
Alignment:
| Q |
19 |
gtgggtgttttaggctttgtttttgctctggatggaagtttcttcaacataaggttttgatcgatcctattattatattaactagttgtaattactagcc |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48089048 |
gtgggtgttttaggctttgtttttgctctggatggaagtttcttcaacataaggttttgatcgatcctattattatattaactagttgtaattactagcc |
48089147 |
T |
|
| Q |
119 |
acaaattattactgtctaatgcttacagtgttttcctgtaattatttgttgtagttctcaaggagaggtgtggggttgggtagtattctacggtggaatg |
218 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48089148 |
acaaattattactgtctaatgcttacagtgtttgcctgtaattatttgttgtagttctcaaggagaggtgtggggttgggtagtattctacggtggaatg |
48089247 |
T |
|
| Q |
219 |
ataggggtggcctttgcttct |
239 |
Q |
| |
|
||||||||||| |||| |||| |
|
|
| T |
48089248 |
ataggggtggcttttggttct |
48089268 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University