View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12518_low_27 (Length: 245)
Name: NF12518_low_27
Description: NF12518
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12518_low_27 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 158; Significance: 3e-84; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 158; E-Value: 3e-84
Query Start/End: Original strand, 16 - 201
Target Start/End: Original strand, 34949632 - 34949817
Alignment:
| Q |
16 |
ctggcaatcctacatctgtttgggcgagggccgatcgataattcctccaagaaatatcttcaaattacaatataattaactaataactatacactgattt |
115 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
34949632 |
ctggcaatcctacatctgtttgggcgagggccgatcgataattcctccaagaaatatcttcaaattacaatataactaactaataactatacactgattt |
34949731 |
T |
|
| Q |
116 |
aaaccaaaatttactatctataataccatgttcgaaatgaccgtctcaccaagcattcagcaatgactatctcgaagtttaacttg |
201 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||| |||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
34949732 |
aaaccaaaatttactataaataataccatgttcgaaatgacagtctcattgagcattcagcaatgactatctcgaagtttaacttg |
34949817 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University