View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
	Query
	Query hiting target	Query hiting target's complemental strand
	Query's complemental strand hiting target	Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF12518_low_32 (Length: 224)

Name: NF12518_low_32

Description: NF12518

Algorithm: BLASTN 2.2.26 [Sep-21-2011]

Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)

[»] NF12518_low_32

[»] chr6 (1 HSPs)

[»] chr5 (1 HSPs)

Target: chr6 (Bit Score: 197; Significance: 1e-107; HSPs: 1)

Name: chr6

Description:

Target: chr6; HSP #1

Raw Score: 197; E-Value: 1e-107

Query Start/End: Original strand, 13 - 209

Target Start/End: Original strand, 34772125 - 34772321

Alignment:

Q	13	tgaagaagaatagaatgaggtttgaagtttctttagatttgtgggaagctatgagtgaagatgaaaagttagtttggagggaccgtggagcaagaaattg	112	Q
		\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|
T	34772125	tgaagaagaatagaatgaggtttgaagtttctttagatttgtgggaagctatgagtgaagatgaaaagttagtttggagggaccgtggagcaagaaattg	34772224	T

Q	113	ctttgaagcaagacttcatggatgggatgctctaggtacgacatccggagacatgaaagaaatgtattgcagactttctaatgcagttgatgttgct	209	Q
		\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|
T	34772225	ctttgaagcaagacttcatggatgggatgctctaggtacgacatccggagacatgaaagaaatgtattgcagactttctaatgcagttgatgttgct	34772321	T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5 (Bit Score: 37; Significance: 0.000000000005; HSPs: 1)

Name: chr5

Description:

Target: chr5; HSP #1

Raw Score: 37; E-Value: 0.000000000005

Query Start/End: Original strand, 121 - 197

Target Start/End: Complemental strand, 9531926 - 9531851

Alignment:

Q	121	caagacttcatggatgggatgctctaggtacgacatccggagacatgaaagaaatgtattgcagactttctaatgca	197	Q
		\|\|\|\|\|\| \|\|\|\|\|\|\|\|\|\|\|\|\|\| \|\|\|\|\|\| \|\|\|\|\|\| \| \|\|\| \|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\| \|\|\|\|\|\|\|\|\|\|\|\|
T	9531926	caagacgtcatggatgggatgttctaggatggacatcag-agagatgaaagaaatgtattgcaggctttctaatgca	9531851	T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]