View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12518_low_32 (Length: 224)
Name: NF12518_low_32
Description: NF12518
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12518_low_32 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 197; Significance: 1e-107; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 197; E-Value: 1e-107
Query Start/End: Original strand, 13 - 209
Target Start/End: Original strand, 34772125 - 34772321
Alignment:
| Q |
13 |
tgaagaagaatagaatgaggtttgaagtttctttagatttgtgggaagctatgagtgaagatgaaaagttagtttggagggaccgtggagcaagaaattg |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34772125 |
tgaagaagaatagaatgaggtttgaagtttctttagatttgtgggaagctatgagtgaagatgaaaagttagtttggagggaccgtggagcaagaaattg |
34772224 |
T |
 |
| Q |
113 |
ctttgaagcaagacttcatggatgggatgctctaggtacgacatccggagacatgaaagaaatgtattgcagactttctaatgcagttgatgttgct |
209 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34772225 |
ctttgaagcaagacttcatggatgggatgctctaggtacgacatccggagacatgaaagaaatgtattgcagactttctaatgcagttgatgttgct |
34772321 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 37; Significance: 0.000000000005; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 121 - 197
Target Start/End: Complemental strand, 9531926 - 9531851
Alignment:
| Q |
121 |
caagacttcatggatgggatgctctaggtacgacatccggagacatgaaagaaatgtattgcagactttctaatgca |
197 |
Q |
| |
|
|||||| |||||||||||||| |||||| |||||| | ||| |||||||||||||||||||| |||||||||||| |
|
|
| T |
9531926 |
caagacgtcatggatgggatgttctaggatggacatcag-agagatgaaagaaatgtattgcaggctttctaatgca |
9531851 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University