View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12518_low_34 (Length: 217)
Name: NF12518_low_34
Description: NF12518
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12518_low_34 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 159; Significance: 8e-85; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 159; E-Value: 8e-85
Query Start/End: Original strand, 13 - 199
Target Start/End: Complemental strand, 5472729 - 5472543
Alignment:
| Q |
13 |
agcaaaggtacacacatgctgactcatttggtttatgggcttgaaactttgaaccatcattgcactcttgtccaccacgtgctgttccattgtcatcgct |
112 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| ||| |
|
|
| T |
5472729 |
agcaaaggtacacacatgctgactcatttggtttatgggcttgaaactttgaaccatcattgcactcttgtccaccacgtgttgttccattgtcattgct |
5472630 |
T |
 |
| Q |
113 |
tctccgggtattggatctgaaccctttgctggtgttgggtttggtgacttgtctgtggatgccattgatgttttctttgtgacttgt |
199 |
Q |
| |
|
|| || || ||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
5472629 |
tcgcccggagttggatctgaaccctttgctggtgttgggtttggtgacttgtcagtggatgccattgatgttttctttgtgacttgt |
5472543 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 74; Significance: 4e-34; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 74; E-Value: 4e-34
Query Start/End: Original strand, 97 - 194
Target Start/End: Original strand, 52074725 - 52074822
Alignment:
| Q |
97 |
ttccattgtcatcgcttctccgggtattggatctgaaccctttgctggtgttgggtttggtgacttgtctgtggatgccattgatgttttctttgtga |
194 |
Q |
| |
|
|||||||||||| |||||||| ||| |||||||||||||||||| ||||||||||||| |||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
52074725 |
ttccattgtcattgcttctccaggtgttggatctgaaccctttgttggtgttgggtttagtgacttgactgtggatgccattgatgttttctttgtga |
52074822 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 50; E-Value: 8e-20
Query Start/End: Original strand, 53 - 102
Target Start/End: Original strand, 52073457 - 52073506
Alignment:
| Q |
53 |
ttgaaactttgaaccatcattgcactcttgtccaccacgtgctgttccat |
102 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52073457 |
ttgaaactttgaaccatcattgcactcttgtccaccacgtgctgttccat |
52073506 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University