View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF12518_low_36 (Length: 201)

Name: NF12518_low_36
Description: NF12518
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF12518_low_36
NF12518_low_36
[»] chr4 (1 HSPs)
chr4 (18-182)||(42003656-42003830)


Alignment Details
Target: chr4 (Bit Score: 120; Significance: 1e-61; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 120; E-Value: 1e-61
Query Start/End: Original strand, 18 - 182
Target Start/End: Complemental strand, 42003830 - 42003656
Alignment:
18 gaacgattaaatgtgttaagtaattcaactagtttgaactaataataaagagttgaaagaccagattcaaattatc----------aaatattaacctaa 107  Q
    |||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||  |||||||||||||           ||||||||||||||    
42003830 gaacgattaaatgtgttaagtaattcaactggtttgaactaataataaagagttgaaagattagattcaaattatggtaaaatagaaaatattaacctaa 42003731  T
108 ccactacgtttcaaaacaaaaatcataactatcgatttaaatctagtctcgtaatcaattggtaggtggcaagac 182  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||    
42003730 ccactacgtttcaaaacaaaaatcataactatcgatttaaatctagtctcgtaatcaattggtaagtggcaagac 42003656  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University