View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12519_low_11 (Length: 249)
Name: NF12519_low_11
Description: NF12519
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12519_low_11 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 138; Significance: 3e-72; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 138; E-Value: 3e-72
Query Start/End: Original strand, 1 - 142
Target Start/End: Complemental strand, 5259375 - 5259234
Alignment:
| Q |
1 |
atgaaacaattttttgtcagattttacttagctaccggctgaattatggattactaacaccgagagagaatcaccacaccaagatttagcccaataatag |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5259375 |
atgaaacaattttttgtcagattttacttagctaccggctgaattatggattactaacactgagagagaatcaccacaccaagatttagcccaataatag |
5259276 |
T |
|
| Q |
101 |
aacaccctttattatgaatcatcaatattcaccaaaaacttc |
142 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5259275 |
aacaccctttattatgaatcatcaatattcaccaaaaacttc |
5259234 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 209 - 241
Target Start/End: Complemental strand, 5259168 - 5259136
Alignment:
| Q |
209 |
gaactttaagaaccaaaccagagtgtctctgct |
241 |
Q |
| |
|
||||||||||||||||||||||||||| ||||| |
|
|
| T |
5259168 |
gaactttaagaaccaaaccagagtgtcgctgct |
5259136 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 34; Significance: 0.0000000003; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 1 - 34
Target Start/End: Complemental strand, 27176406 - 27176373
Alignment:
| Q |
1 |
atgaaacaattttttgtcagattttacttagcta |
34 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
27176406 |
atgaaacaattttttgtcagattttacttagcta |
27176373 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University