View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12519_low_8 (Length: 263)
Name: NF12519_low_8
Description: NF12519
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12519_low_8 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 115; Significance: 2e-58; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 115; E-Value: 2e-58
Query Start/End: Original strand, 1 - 115
Target Start/End: Original strand, 5259400 - 5259514
Alignment:
| Q |
1 |
tattttatggagtaattgaacatgagagtcgctgttttcttttttggtgagttttaattctagcccttgttttggcgtttctgatgagtaattaatgagt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5259400 |
tattttatggagtaattgaacatgagagtcgctgttttcttttttggtgagttttaattctagcccttgttttggcgtttctgatgagtaattaatgagt |
5259499 |
T |
|
| Q |
101 |
gttctagattaagca |
115 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
5259500 |
gttctagattaagca |
5259514 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 104; E-Value: 6e-52
Query Start/End: Original strand, 151 - 254
Target Start/End: Original strand, 5259556 - 5259659
Alignment:
| Q |
151 |
ccataattatgaaatattggcacagttaaaggcaaaaatgagatattttctggtttgtttcattaatttagaagatattgtggtgtcagtagggttggtg |
250 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5259556 |
ccataattatgaaatattggcacagttaaaggcaaaaatgagatattttctggtttgtttcattaatttagaagatattgtggtgtcagtagggttggtg |
5259655 |
T |
|
| Q |
251 |
atgt |
254 |
Q |
| |
|
|||| |
|
|
| T |
5259656 |
atgt |
5259659 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University