View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1251_high_13 (Length: 258)
Name: NF1251_high_13
Description: NF1251
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1251_high_13 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 141; Significance: 5e-74; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 141; E-Value: 5e-74
Query Start/End: Original strand, 12 - 156
Target Start/End: Original strand, 24915867 - 24916011
Alignment:
| Q |
12 |
aaagggtcactgagaacatgtcatttggtcaattctagtagccgcatcagtattttttaccaagtttacaggctgagttaaggtcacttacaaatagtgg |
111 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24915867 |
aaagggtcactgagaacatgtcatttggtcaattctagtagccgcatcagtattttttacctagtttacaggctgagttaaggtcacttacaaatagtgg |
24915966 |
T |
 |
| Q |
112 |
agtaactaatgtcagaatcaatgtaactagaataatggtttgccc |
156 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24915967 |
agtaactaatgtcagaatcaatgtaactagaataatggtttgccc |
24916011 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University