View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1251_high_14 (Length: 251)
Name: NF1251_high_14
Description: NF1251
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1251_high_14 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 166; Significance: 6e-89; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 166; E-Value: 6e-89
Query Start/End: Original strand, 65 - 242
Target Start/End: Original strand, 24915691 - 24915868
Alignment:
| Q |
65 |
actgcttgtgcatgtttatttgtatgtcgcttgtgaattgtgactgcttgtgcaagtttacgtgtgtgctgcttgtgcattgagatcataaaatattttc |
164 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24915691 |
actgcttgtgcatgtttatttgtgtgtcgcttgtgaattgtgactgcttgtgcaagtttacgtgtgtgctgcttgtgcattgagatcataaaatattttc |
24915790 |
T |
 |
| Q |
165 |
tcttcactaattaaacaactgctttgttgttagaatagactacctaaatcaatgtttgaagataacaatgatttgtaa |
242 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
24915791 |
tcttcactaattaaacaactactttgttgttagaatagactacctaaatcaatgtttgaagataacaatgatatgtaa |
24915868 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University