View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1251_high_7 (Length: 290)
Name: NF1251_high_7
Description: NF1251
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1251_high_7 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 54; Significance: 5e-22; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 54; E-Value: 5e-22
Query Start/End: Original strand, 29 - 90
Target Start/End: Original strand, 15556481 - 15556542
Alignment:
| Q |
29 |
agatttgaccggcacaatcctctttgttggacaggtgctcaatcctcttgctgggtaatcat |
90 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||| ||||||||||||||| |
|
|
| T |
15556481 |
agatttgaccggcacaatcctctttgttggacaggtgcttaatccttttgctgggtaatcat |
15556542 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 44; Significance: 4e-16; HSPs: 8)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 33 - 84
Target Start/End: Original strand, 46480269 - 46480320
Alignment:
| Q |
33 |
ttgaccggcacaatcctctttgttggacaggtgctcaatcctcttgctgggt |
84 |
Q |
| |
|
|||||||| |||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
46480269 |
ttgaccggaacaatcatctttgttggacaggtgctcaatcctcttgctgggt |
46480320 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 33 - 84
Target Start/End: Original strand, 46491182 - 46491233
Alignment:
| Q |
33 |
ttgaccggcacaatcctctttgttggacaggtgctcaatcctcttgctgggt |
84 |
Q |
| |
|
||||| || |||||| ||||||||||||||||| |||||||||||||||||| |
|
|
| T |
46491182 |
ttgactggaacaatcatctttgttggacaggtgttcaatcctcttgctgggt |
46491233 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 29 - 80
Target Start/End: Original strand, 46498420 - 46498471
Alignment:
| Q |
29 |
agatttgaccggcacaatcctctttgttggacaggtgctcaatcctcttgct |
80 |
Q |
| |
|
|||||||||||| || ||| |||||||||| ||||||||||||||||||||| |
|
|
| T |
46498420 |
agatttgaccggaactatcgtctttgttgggcaggtgctcaatcctcttgct |
46498471 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #4
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 30 - 84
Target Start/End: Original strand, 46474396 - 46474450
Alignment:
| Q |
30 |
gatttgaccggcacaatcctctttgttggacaggtgctcaatcctcttgctgggt |
84 |
Q |
| |
|
|||||| |||| |||||| ||||||||||||||||||| |||||||||| ||||| |
|
|
| T |
46474396 |
gatttggccggaacaatcatctttgttggacaggtgcttaatcctcttgatgggt |
46474450 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #5
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 51 - 84
Target Start/End: Complemental strand, 46506876 - 46506843
Alignment:
| Q |
51 |
tttgttggacaggtgctcaatcctcttgctgggt |
84 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
46506876 |
tttgttggacaggtgctcaatcctcttgctgggt |
46506843 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #6
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 42 - 78
Target Start/End: Complemental strand, 47413833 - 47413797
Alignment:
| Q |
42 |
acaatcctctttgttggacaggtgctcaatcctcttg |
78 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||| |
|
|
| T |
47413833 |
acaatcctctttgttggacatgtgctcaatcctcttg |
47413797 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #7
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 35 - 74
Target Start/End: Complemental strand, 46236434 - 46236395
Alignment:
| Q |
35 |
gaccggcacaatcctctttgttggacaggtgctcaatcct |
74 |
Q |
| |
|
|||||| ||||||||||||| ||||||||||||||||||| |
|
|
| T |
46236434 |
gaccggaacaatcctctttgctggacaggtgctcaatcct |
46236395 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #8
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 29 - 70
Target Start/End: Original strand, 51944362 - 51944403
Alignment:
| Q |
29 |
agatttgaccggcacaatcctctttgttggacaggtgctcaa |
70 |
Q |
| |
|
||||||||| || |||||| |||||||||||||||||||||| |
|
|
| T |
51944362 |
agatttgactggaacaatcatctttgttggacaggtgctcaa |
51944403 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 30; Significance: 0.0000001; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 29 - 78
Target Start/End: Complemental strand, 20168676 - 20168627
Alignment:
| Q |
29 |
agatttgaccggcacaatcctctttgttggacaggtgctcaatcctcttg |
78 |
Q |
| |
|
||||||||| || |||||||||||||| || || |||||||||||||||| |
|
|
| T |
20168676 |
agatttgacgggaacaatcctctttgtcgggcaagtgctcaatcctcttg |
20168627 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 29 - 78
Target Start/End: Original strand, 20359608 - 20359657
Alignment:
| Q |
29 |
agatttgaccggcacaatcctctttgttggacaggtgctcaatcctcttg |
78 |
Q |
| |
|
||||||||| || |||||||||||||| || || |||||||||||||||| |
|
|
| T |
20359608 |
agatttgacgggaacaatcctctttgtcgggcaagtgctcaatcctcttg |
20359657 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University