View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1251_low_18 (Length: 324)

Name: NF1251_low_18
Description: NF1251
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1251_low_18
NF1251_low_18
[»] chr8 (1 HSPs)
chr8 (100-235)||(32815556-32815691)


Alignment Details
Target: chr8 (Bit Score: 136; Significance: 6e-71; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 136; E-Value: 6e-71
Query Start/End: Original strand, 100 - 235
Target Start/End: Complemental strand, 32815691 - 32815556
Alignment:
100 gttgcgttgaatgaaagaatactttcttccatggctgataagaaagatgctgctgctcatccatggcatgacttagagattggtattattattaactaac 199  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
32815691 gttgcgttgaatgaaagaatactttcttccatggctgataagaaagatgctgctgctcatccatggcatgacttagagattggtattattattaactaac 32815592  T
200 tcttttttacgtttctttattcttctttctgcttca 235  Q
    ||||||||||||||||||||||||||||||||||||    
32815591 tcttttttacgtttctttattcttctttctgcttca 32815556  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University