View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1251_low_22 (Length: 311)
Name: NF1251_low_22
Description: NF1251
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1251_low_22 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 97; Significance: 1e-47; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 97; E-Value: 1e-47
Query Start/End: Original strand, 137 - 244
Target Start/End: Original strand, 9972368 - 9972476
Alignment:
| Q |
137 |
gatttcatgtccaacatcttgacacatgtacacatcatagacatggattggttatgtactttttcctt-aaaaacattgttacgcactttaatgtcattt |
235 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
9972368 |
gatttcatgtccaacatcttgacacatgtgcacatcatagacatggattggttatgtactttttccttaaaaaacattgttacgcactttaatgtcattt |
9972467 |
T |
|
| Q |
236 |
taaatttac |
244 |
Q |
| |
|
||||||||| |
|
|
| T |
9972468 |
taaatttac |
9972476 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 259 - 287
Target Start/End: Original strand, 9972460 - 9972488
Alignment:
| Q |
259 |
tgtcattttaaatttacaaaagctaaact |
287 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
9972460 |
tgtcattttaaatttacaaaagctaaact |
9972488 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University