View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1251_low_24 (Length: 307)

Name: NF1251_low_24
Description: NF1251
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1251_low_24
NF1251_low_24
[»] chr3 (1 HSPs)
chr3 (83-204)||(45276730-45276851)


Alignment Details
Target: chr3 (Bit Score: 114; Significance: 8e-58; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 114; E-Value: 8e-58
Query Start/End: Original strand, 83 - 204
Target Start/End: Complemental strand, 45276851 - 45276730
Alignment:
83 aataatatcaactttggaactcgaacttttgcgaccaaccagtaaatcaaaacgttaacagccactgaaccacttagcacattaataaaatggggcaatt 182  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |||||    
45276851 aataatatcaactttggaactcgaacttttgcgaccaaccagtaaatcaaaacgttaacagccactgcaccacttagcacattaataaaatgggacaatt 45276752  T
183 tatttttgttaatatggcttat 204  Q
    ||||||||||||||||||||||    
45276751 tatttttgttaatatggcttat 45276730  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University