View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1251_low_26 (Length: 303)

Name: NF1251_low_26
Description: NF1251
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1251_low_26
NF1251_low_26
[»] chr4 (1 HSPs)
chr4 (104-159)||(54277152-54277207)


Alignment Details
Target: chr4 (Bit Score: 52; Significance: 8e-21; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 52; E-Value: 8e-21
Query Start/End: Original strand, 104 - 159
Target Start/End: Original strand, 54277152 - 54277207
Alignment:
104 cttattacacaaataaacagattaatttctcagtgttcccttattcatttcgtatg 159  Q
    |||||||||||||||||||||||||||||| |||||||||||||||||||||||||    
54277152 cttattacacaaataaacagattaatttcttagtgttcccttattcatttcgtatg 54277207  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University