View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1251_low_31 (Length: 271)
Name: NF1251_low_31
Description: NF1251
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1251_low_31 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 222; Significance: 1e-122; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 222; E-Value: 1e-122
Query Start/End: Original strand, 30 - 259
Target Start/End: Original strand, 28274205 - 28274434
Alignment:
| Q |
30 |
ctaaccatggtcatgagaagacgtcttaccatgggcatgaagtaatcgtcttggatgatgatgacaacaaagttccaggacaaactgatgtcaattttca |
129 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28274205 |
ctaaccatggtcatgagaagacgtcttaccatgggcatgaagtagtcgtcttggatgatgatgacaacaaagttccaggacaaactgatgtcaattttca |
28274304 |
T |
 |
| Q |
130 |
ggctgatctcagaaaagcaaaacaggaagatatcaaccttagtctgactttaaatgatcacaatatagctgtaaactcagataacataagcagtgtagtt |
229 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28274305 |
ggctgatctcagaaaagcagaacaggaagatatcaaccttagtctgactttaaatgatcacaatatagctgtaaactcagataacataagcagtgtagtt |
28274404 |
T |
 |
| Q |
230 |
gatacaggtacaccttttcgctagcagtat |
259 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
28274405 |
gatacaggtacaccttttcgctagcagtat |
28274434 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University