View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1251_low_34 (Length: 267)
Name: NF1251_low_34
Description: NF1251
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1251_low_34 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 212; Significance: 1e-116; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 212; E-Value: 1e-116
Query Start/End: Original strand, 29 - 244
Target Start/End: Complemental strand, 35034869 - 35034654
Alignment:
| Q |
29 |
agaaaggttgcatcatggtattgcccgacatgtttaataaaggccacatcatggtattaggccaaccgtaattcataccataaggtatatagccatattg |
128 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35034869 |
agaaaggttgcatcatggtattgcccgacatgtttaataaaggccacatcatggtattaggccaaccgtaattcataccataaggtatatagccatattg |
35034770 |
T |
|
| Q |
129 |
gtgaaaaggagggagagggtgaaccataggcaatgcagatggtggtgatggtggtggcggcatgctgacatttctacgcactccagctgcattagtattt |
228 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
35034769 |
gtgaaaaggagggagagggtgaaccataggcaatgcagatggtggtgatggtggtggcggcatgctggcatttctacgcactccagctgcattagtattt |
35034670 |
T |
|
| Q |
229 |
ctcgagtatgttggtc |
244 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
35034669 |
ctcgagtatgttggtc |
35034654 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University