View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1251_low_39 (Length: 251)
Name: NF1251_low_39
Description: NF1251
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1251_low_39 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 67; Significance: 7e-30; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 67; E-Value: 7e-30
Query Start/End: Original strand, 1 - 209
Target Start/End: Original strand, 48989103 - 48989307
Alignment:
| Q |
1 |
acgaaacttatgtggctttagtgctgnnnnnnnnggattattgatataacccatgcttgnnnnnnncgtggttctttttaggcactactccttatacttg |
100 |
Q |
| |
|
|||| ||||||||||||||||||||| ||||||||||| |||| |||||||| | ||||||||||||| |||||||||||||||||| |
|
|
| T |
48989103 |
acgagacttatgtggctttagtgctgttttttt-ggattattgatgtaactcatgcttgtttttttcttggttctttttagacactactccttatacttg |
48989201 |
T |
|
| Q |
101 |
ccagactaaatgttttgatttttaatttcattttaccttcttcaaannnnnnnnnnnnnnnnngtacgttacaatttgaccaagctgcaattacttccat |
200 |
Q |
| |
|
||| |||||||||| |||||||||||||||||||| |||||||||| ||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
48989202 |
ccaaactaaatgttctgatttttaatttcattttagcttcttcaaa---aataataataataagtatgttacaatttgaccaagctgcaattacttccat |
48989298 |
T |
|
| Q |
201 |
atctcaatt |
209 |
Q |
| |
|
||||||||| |
|
|
| T |
48989299 |
atctcaatt |
48989307 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University