View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1251_low_6 (Length: 434)
Name: NF1251_low_6
Description: NF1251
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1251_low_6 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 145; Significance: 4e-76; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 145; E-Value: 4e-76
Query Start/End: Original strand, 9 - 197
Target Start/End: Original strand, 8462301 - 8462484
Alignment:
| Q |
9 |
accacagatcagaattattattactactattttgttatgaattttatctgttttcaatttttggaagtttgtttcggatatccaaaattgaaaataaatg |
108 |
Q |
| |
|
|||||| ||| ||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8462301 |
accacaaatcggaattattattactactattttgttatgaattttatctgttttcaatttttagaagtttgtttcggatatccaaaattgaaaataaatg |
8462400 |
T |
|
| Q |
109 |
taaacagtgtgttcctttcttaataaaatcttttaccttatcttatctgtgtatgattcttcatcgattaacaacacattgtaaaattt |
197 |
Q |
| |
|
|||||||||||| |||||||| |||||||||||||| |||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8462401 |
taaacagtgtgtccctttcttgataaaatcttttac-----cttatctgtgcatgattcttcatcgattaacaacacattgtaaaattt |
8462484 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 56; Significance: 5e-23; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 56; E-Value: 5e-23
Query Start/End: Original strand, 36 - 127
Target Start/End: Complemental strand, 34092769 - 34092678
Alignment:
| Q |
36 |
tattttgttatgaattttatctgttttcaatttttggaagtttgtttcggatatccaaaattgaaaataaatgtaaacagtgtgttcctttc |
127 |
Q |
| |
|
||||| ||||| ||||||||| |||||||||||||| ||||| |||||||||| ||||||||||| ||||||||||||||| ||| |||||| |
|
|
| T |
34092769 |
tatttggttattaattttatcagttttcaatttttgaaagttggtttcggatagccaaaattgaagataaatgtaaacagtatgtccctttc |
34092678 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University