View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1252-Insertion-1 (Length: 110)
Name: NF1252-Insertion-1
Description: NF1252
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1252-Insertion-1 |
 | |
|
| [»] chr2 (1 HSPs) |
| |
|
Alignment Details
Target: chr2 (Bit Score: 95; Significance: 5e-47; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 95; E-Value: 5e-47
Query Start/End: Original strand, 8 - 110
Target Start/End: Original strand, 13967157 - 13967259
Alignment:
| Q |
8 |
tcaactatgctgatggtgtcaacacttacaatactgcaactttcggtaagttctaaagaattcacgcaaaatgttttttagcggaaaatattattattgt |
107 |
Q |
| |
|
||||||||||||||||| ||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13967157 |
tcaactatgctgatggtatcaacacttacaaaactgcaactttcggtaagttctaaagaattcacgcaaaatgttttttagcggaaaatattattattgt |
13967256 |
T |
|
| Q |
108 |
tag |
110 |
Q |
| |
|
||| |
|
|
| T |
13967257 |
tag |
13967259 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 28; Significance: 0.0000005; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 28; E-Value: 0.0000005
Query Start/End: Original strand, 12 - 59
Target Start/End: Complemental strand, 49865447 - 49865400
Alignment:
| Q |
12 |
ctatgctgatggtgtcaacacttacaatactgcaactttcggtaagtt |
59 |
Q |
| |
|
||||||||||||||| | ||||||||||| ||||| ||||||||||| |
|
|
| T |
49865447 |
ctatgctgatggtgtgcagacttacaataccgcaacattcggtaagtt |
49865400 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University