View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1252-Insertion-2 (Length: 139)
Name: NF1252-Insertion-2
Description: NF1252
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1252-Insertion-2 |
 |  |
|
| [»] chr7 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 108; Significance: 1e-54; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 108; E-Value: 1e-54
Query Start/End: Original strand, 8 - 139
Target Start/End: Complemental strand, 6642613 - 6642482
Alignment:
| Q |
8 |
ccctcatggtagggaagatattcatgttaggtttaaatagttagattgtcttcgtaagctcgcatgatttttattttcgcctctgtatctttttggttat |
107 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| ||||||| |||||||||||| |||||||||||||||||||| |
|
|
| T |
6642613 |
ccctcatggtagggaagatattcatgttaggtttaaatagttaaattgtcttcgtaagttcgcatgttttttattttcgtctctgtatctttttggttat |
6642514 |
T |
 |
| Q |
108 |
aaaataaatattgtaagatgcaaacattttga |
139 |
Q |
| |
|
|||| ||| ||||||||||||||||||||||| |
|
|
| T |
6642513 |
aaaacaaacattgtaagatgcaaacattttga |
6642482 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University