View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12521_low_13 (Length: 391)
Name: NF12521_low_13
Description: NF12521
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12521_low_13 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 144; Significance: 1e-75; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 144; E-Value: 1e-75
Query Start/End: Original strand, 32 - 222
Target Start/End: Complemental strand, 40284571 - 40284381
Alignment:
| Q |
32 |
tgtgttaggttttacttttccttttgataaattctttcatgcgtgctcgtatccacttttattctaatgaacattgttactttgattaatagagtacatc |
131 |
Q |
| |
|
|||||||||||||||||||| ||||||| ||||||||||||||||||||| |||| ||||||| ||||||||||||||||||||||||||| |||||||| |
|
|
| T |
40284571 |
tgtgttaggttttacttttctttttgatcaattctttcatgcgtgctcgtgtccatttttattttaatgaacattgttactttgattaatatagtacatc |
40284472 |
T |
 |
| Q |
132 |
tctcagtctcagtagttgatatcactctgattggaattttgctttatattttgaatttct-aatgtgtatgattgaaattactactactact |
222 |
Q |
| |
|
||||||||| |||||||||||||||||| ||||||||||||||||||||||||||||||| ||||||||||||||||||| ||||||||||| |
|
|
| T |
40284471 |
tctcagtcttagtagttgatatcactctaattggaattttgctttatattttgaatttctaaatgtgtatgattgaaatt-ctactactact |
40284381 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 49; E-Value: 6e-19
Query Start/End: Original strand, 325 - 385
Target Start/End: Complemental strand, 40284368 - 40284308
Alignment:
| Q |
325 |
acattaaatgtaggcatctctatcaatagcgatttggtatcttggttcgccacatttgtgg |
385 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||| ||||||||||||||||| |||||| |
|
|
| T |
40284368 |
acattaaatgtaggcatctctatcagtagcgatttgatatcttggttcgccacaattgtgg |
40284308 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University