View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12521_low_15 (Length: 384)
Name: NF12521_low_15
Description: NF12521
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12521_low_15 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 163; Significance: 6e-87; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 163; E-Value: 6e-87
Query Start/End: Original strand, 4 - 190
Target Start/End: Complemental strand, 31658769 - 31658583
Alignment:
| Q |
4 |
aattgttctcatcagataacctaatatcgtgtaactttgaatttggttttgattatttgagacatgccactatgctatcatcgattgaatcatttgaatt |
103 |
Q |
| |
|
|||||||||||||||||||||| ||||| |||||||||||| || ||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
31658769 |
aattgttctcatcagataacctcatatcatgtaactttgaagtttattttgattatttgagacgtgccactatgctatcatcgattgaatcatttgaatt |
31658670 |
T |
 |
| Q |
104 |
tgagaatgtttatgaccagttaggattttgatggctatggatatgtttctgtctaagtgtaaatttattttcaaagtttggcattgg |
190 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31658669 |
tgagaatgtttatgaccagttaggattttgatggctatggatatgtttctgtctaagtgtaaatttattttcaaagtttggcattgg |
31658583 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 62; E-Value: 1e-26
Query Start/End: Original strand, 291 - 356
Target Start/End: Complemental strand, 31658558 - 31658493
Alignment:
| Q |
291 |
taatgggagatttatttgatcgtttaacttatgatgtcttgctcagttggttgataaattgataaa |
356 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
31658558 |
taatgggagatttatttgatcgtttaacttatgatgtcttgctcagttagttgataaattgataaa |
31658493 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University