View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12521_low_27 (Length: 333)
Name: NF12521_low_27
Description: NF12521
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12521_low_27 |
 | |
|
| [»] chr1 (2 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 209; Significance: 1e-114; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 209; E-Value: 1e-114
Query Start/End: Original strand, 89 - 333
Target Start/End: Complemental strand, 26969134 - 26968890
Alignment:
| Q |
89 |
agaaaactgcagagacagcggaagctgctaaacagaaaactgcagaaaccactgaggctgctaagcaaaagacagtagaggcaaaagacaagaccaaggt |
188 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||| || | || |||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
26969134 |
agaaaactgcagagacagcagaagctgctaaacagaaaactgcagagacagcagaagctgctaaacaaaagacagtagaggcaaaagacaagaccaaggt |
26969035 |
T |
|
| Q |
189 |
aacaaatttgaatttatggtagtatatgtttttgatgtttgagatatttattgatcagtggttgtggaattttggcatggataatgcaggaaatgttgag |
288 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
26969034 |
aacaaatttgaatttatggtagtatatgtttttgatgtttgagatatttattgattagtggttgtggaatttttgcatggataatgcaggaaatgttgag |
26968935 |
T |
|
| Q |
289 |
tgaagcagataaagaagcagggaggaaaatggaaagtggaaatta |
333 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26968934 |
tgaagcagataaagaagcagggaggaaaatggaaagtggaaatta |
26968890 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 108; E-Value: 3e-54
Query Start/End: Original strand, 11 - 134
Target Start/End: Complemental strand, 26969245 - 26969122
Alignment:
| Q |
11 |
gtgagatgaaagactctgctgttgatgcggcgaaacgggctatgggttacttgggtgacaagaaagaggaagctaaggagaaaactgcagagacagcgga |
110 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| || |
|
|
| T |
26969245 |
gtgagatgaaggactctgctgttgatgcggcgaaacgggctatgggttacttgggtgacaagaaagaggaagctaaacagaaaactgcagagacagcaga |
26969146 |
T |
|
| Q |
111 |
agctgctaaacagaaaactgcaga |
134 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
26969145 |
agctgctaaacagaaaactgcaga |
26969122 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University