View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12521_low_35 (Length: 306)
Name: NF12521_low_35
Description: NF12521
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12521_low_35 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 279; Significance: 1e-156; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 279; E-Value: 1e-156
Query Start/End: Original strand, 17 - 295
Target Start/End: Original strand, 2447124 - 2447402
Alignment:
| Q |
17 |
cagtgaaaagcttgcaatagcttttgctcttttgaacactccccctggaacatcaattaggattgtgaagaacttgcgtgtctgcgaagattgtcattct |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2447124 |
cagtgaaaagcttgcaatagcttttgctcttttgaacactccccctggaacatcaattaggattgtgaagaacttgcgtgtctgcgaagattgtcattct |
2447223 |
T |
|
| Q |
117 |
gctactaagtttatatctaaggtttataatcgagagattgtcgtcagggaccgcaatcgcttccaccatttcaagaatggtttgtgctcttgtagagact |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2447224 |
gctactaagtttatatctaaggtttataatcgagagattgtcgtcagggaccgcaatcgcttccaccatttcaagaatggtttgtgctcttgtagagact |
2447323 |
T |
|
| Q |
217 |
tttggtaattgaaaacgattagaaagttaaaaattatgtgttcatttgctgaaaattaatggtgtcttctactgatgtc |
295 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2447324 |
tttggtaattgaaaacgattagaaagttaaaaattatgtgttcatttgctgaaaattaatggtgtcttctactgatgtc |
2447402 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 34; Significance: 0.0000000004; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 76 - 141
Target Start/End: Complemental strand, 43567737 - 43567672
Alignment:
| Q |
76 |
ggattgtgaagaacttgcgtgtctgcgaagattgtcattctgctactaagtttatatctaaggttt |
141 |
Q |
| |
|
|||||||||| |||||||||||||| ||||||||||| | ||||| |||||||| || ||||||| |
|
|
| T |
43567737 |
ggattgtgaaaaacttgcgtgtctgtgaagattgtcacacagctaccaagtttatctcgaaggttt |
43567672 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University