View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12521_low_40 (Length: 279)
Name: NF12521_low_40
Description: NF12521
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12521_low_40 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 134; Significance: 8e-70; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 134; E-Value: 8e-70
Query Start/End: Original strand, 6 - 179
Target Start/End: Original strand, 5663561 - 5663734
Alignment:
| Q |
6 |
ggacgttggagtttgctagacttaaaatttgtatgtttggcattgagtagaatccaaaataggtttattctattgtacttgatttatttctaattgtttt |
105 |
Q |
| |
|
|||||||||||||||||||||||||||||| || |||||||||||||||||||| |||| |||||||||||||||| ||||||||||||||||| ||||| |
|
|
| T |
5663561 |
ggacgttggagtttgctagacttaaaatttttacgtttggcattgagtagaatcaaaaacaggtttattctattgtccttgatttatttctaatggtttt |
5663660 |
T |
 |
| Q |
106 |
tatgctactgttgttgtgattttttatcaatgcagtcaattttcaatagagctgcttctatatactgttaattg |
179 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |||| | ||||||| |
|
|
| T |
5663661 |
tatgctactgttgttgtcattttttatcaatgcagtcaattttcaatagagctgcttctgtatatttttaattg |
5663734 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University