View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12521_low_46 (Length: 250)
Name: NF12521_low_46
Description: NF12521
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12521_low_46 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 162; Significance: 1e-86; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 162; E-Value: 1e-86
Query Start/End: Original strand, 1 - 248
Target Start/End: Complemental strand, 30700885 - 30700641
Alignment:
| Q |
1 |
caattgtttcactagttctctcaatccaccctaatgcattcaatgacgttctggcgatcatcgacccaactattgaaggttgt-------aatgacttgg |
93 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||||||| |||||||||||| |||||||||||||||||||||| |||||||||| |
|
|
| T |
30700885 |
caattgtttcactagttctctcaatccaccctaatacattcaatgaccttctggcgatcaccgacccaactattgaaggttgttgtttgtaatgacttgg |
30700786 |
T |
 |
| Q |
94 |
ctttactccaccatgactctccttttcgtaaatgtataaatacatactttcatattgtaatgcaaggtatatcttttttccacctaaaaatttatcactc |
193 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||||||||||| |||| ||||||||||||||||||||| ||||||||| |
|
|
| T |
30700785 |
ctttactccaccatgactctccttttcgtaaatgtataaatgcatactttcataatgta----------tatcttttttccacctaaaaacttatcactc |
30700696 |
T |
 |
| Q |
194 |
ttcaccctcttctctttctcaatacacgtcacagttacattttcatctcactcga |
248 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
30700695 |
ttcaccctcttctctttctcaatacacgtcacagttacattttcaaatcactcga |
30700641 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University