View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12521_low_47 (Length: 249)
Name: NF12521_low_47
Description: NF12521
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12521_low_47 |
 | |
|
| [»] chr5 (1 HSPs) |
| |
|
Alignment Details
Target: chr5 (Bit Score: 229; Significance: 1e-126; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 229; E-Value: 1e-126
Query Start/End: Original strand, 9 - 249
Target Start/End: Original strand, 1527428 - 1527668
Alignment:
| Q |
9 |
gcagagaatacgtaggacttgttttgaaatttcagtttttattaaaagaatatgggatacgatgaataagctccagactatctggtcatggtggtaagta |
108 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
1527428 |
gcagagaatacgtaggacttgttttgaaatttcagtttttattaaaagaatgtgggatacgatgaataaactccagactatctggtcatggtggtaagta |
1527527 |
T |
|
| Q |
109 |
ttcaagcgtttatagaacccttaaaagttggctatcaagggggaggaatcaaaccactcaaatgcttcattgagcatctcatattgcttgtacttggtct |
208 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
1527528 |
ttcaagcgtttatagaacccttaaaagttggctatcaagggggaggaatcaaaccactcaaatgcttcattgagcatctcatattgcttgtactcggtct |
1527627 |
T |
|
| Q |
209 |
tcccggtctacccattcgtaggtagccctttctgagtcacc |
249 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1527628 |
tcccggtctacccattcgtaggtagccctttctgagtcacc |
1527668 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University