View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12521_low_48 (Length: 248)
Name: NF12521_low_48
Description: NF12521
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12521_low_48 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 229; Significance: 1e-126; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 229; E-Value: 1e-126
Query Start/End: Original strand, 1 - 233
Target Start/End: Original strand, 1527764 - 1527996
Alignment:
| Q |
1 |
cgaacatcccatactactcaatgtggattagggcaccccatattaccaaagtccctatcacatagatgctctaatacaatgtcatgaagcaactatttca |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1527764 |
cgaacatcccatactactcaatgtggattagggcaccccatattaccaaagtccctatcacatagatgctctaatacaatgtcatgaagcaactatttca |
1527863 |
T |
|
| Q |
101 |
aaaatttaacatgtttagtaacacgattaattttgtctttctttattaattattaacctttgtcaattccaaggtctgtaggttttcttggttttatctc |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
1527864 |
aaaatttaacatgtttagtaacacgattaattttgtctttctttattaattattaacctttgtcaattccaaggtctgtagtttttcttggttttatctc |
1527963 |
T |
|
| Q |
201 |
ctaatttatgatcatacgtttgttattgatgtc |
233 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
1527964 |
ctaatttatgatcatacgtttgttattgatgtc |
1527996 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 29; Significance: 0.0000003; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 5 - 60
Target Start/End: Original strand, 1442242 - 1442298
Alignment:
| Q |
5 |
catcccatactactcaatgtgg-attagggcaccccatattaccaaagtccctatca |
60 |
Q |
| |
|
||||||||||||||| |||||| | | |||||||||||| |||| |||||||||||| |
|
|
| T |
1442242 |
catcccatactactcgatgtggtacttgggcaccccatactacccaagtccctatca |
1442298 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 3 - 62
Target Start/End: Complemental strand, 37483148 - 37483088
Alignment:
| Q |
3 |
aacatcccatactactcaatgtggat-tagggcaccccatattaccaaagtccctatcaca |
62 |
Q |
| |
|
|||||||||||||||| ||||||| | |||||||||||| |||| |||||||||||||| |
|
|
| T |
37483148 |
aacatcccatactacttgatgtggaacttgggcaccccataatacccaagtccctatcaca |
37483088 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University