View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12521_low_6 (Length: 463)
Name: NF12521_low_6
Description: NF12521
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12521_low_6 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 112; Significance: 2e-56; HSPs: 3)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 112; E-Value: 2e-56
Query Start/End: Original strand, 329 - 455
Target Start/End: Complemental strand, 20410017 - 20409890
Alignment:
| Q |
329 |
gtacctgattagtgttcgatgaacaccattgaagacgaagaatttaccgttgaaggaaaatcaaatcgccg-aaatcgaagagaaaaccctagtagcaga |
427 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
20410017 |
gtacctgattagtgttcgatgaacaccattgaagacgaagaattttccgttgaaggaaaatcaaatcgccgaaaatcgaagagaaaaccctagtagcaga |
20409918 |
T |
|
| Q |
428 |
aaatgcagagagaacgatggtttcttct |
455 |
Q |
| |
|
|||||||||||||||||| ||||||||| |
|
|
| T |
20409917 |
aaatgcagagagaacgatagtttcttct |
20409890 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 74; E-Value: 9e-34
Query Start/End: Original strand, 171 - 244
Target Start/End: Complemental strand, 20410175 - 20410102
Alignment:
| Q |
171 |
tgaattgagagaaaaacgtacctgattagtgaaagaacaccaccattgaagaagatgaatattctgcttcaagg |
244 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
20410175 |
tgaattgagagaaaaacgtacctgattagtgaaagaacaccaccattgaagaagatgaatattctgcttcaagg |
20410102 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 17 - 55
Target Start/End: Complemental strand, 20410328 - 20410290
Alignment:
| Q |
17 |
aattcccaccttaaaattttagggtttactcagatcctg |
55 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
20410328 |
aattcccaccttaaaattttagggtttactcagatcctg |
20410290 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University