View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF12522_high_3 (Length: 414)

Name: NF12522_high_3
Description: NF12522
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF12522_high_3
NF12522_high_3
[»] chr5 (9 HSPs)
chr5 (18-332)||(23166252-23166579)
chr5 (358-404)||(23166605-23166651)
chr5 (268-315)||(5711788-5711835)
chr5 (268-315)||(9270337-9270384)
chr5 (269-315)||(10365201-10365247)
chr5 (269-315)||(38477487-38477533)
chr5 (268-315)||(14197703-14197750)
chr5 (272-315)||(19965002-19965045)
chr5 (268-314)||(14463675-14463721)
[»] chr2 (4 HSPs)
chr2 (268-316)||(43325367-43325415)
chr2 (268-312)||(43317705-43317749)
chr2 (272-315)||(5377571-5377614)
chr2 (268-315)||(35060418-35060466)
[»] scaffold0122 (1 HSPs)
scaffold0122 (268-315)||(11654-11701)
[»] chr7 (4 HSPs)
chr7 (268-315)||(8227126-8227173)
chr7 (268-315)||(19756514-19756561)
chr7 (267-316)||(11677725-11677774)
chr7 (268-316)||(9626466-9626514)
[»] chr6 (4 HSPs)
chr6 (268-315)||(19686633-19686680)
chr6 (268-315)||(26860218-26860265)
chr6 (268-315)||(29208377-29208424)
chr6 (272-316)||(15917644-15917688)
[»] chr3 (4 HSPs)
chr3 (268-315)||(43366226-43366273)
chr3 (268-314)||(15510664-15510710)
chr3 (268-311)||(24912602-24912645)
chr3 (272-315)||(32311608-32311651)
[»] chr1 (4 HSPs)
chr1 (268-315)||(24029817-24029864)
chr1 (268-315)||(45931651-45931698)
chr1 (269-315)||(46239898-46239944)
chr1 (268-313)||(9154531-9154576)
[»] chr4 (8 HSPs)
chr4 (268-314)||(54452030-54452076)
chr4 (272-315)||(5609544-5609587)
chr4 (268-315)||(11673961-11674008)
chr4 (268-315)||(24703295-24703342)
chr4 (269-315)||(418407-418453)
chr4 (274-315)||(21095458-21095499)
chr4 (270-315)||(30819948-30819993)
chr4 (268-316)||(13610732-13610780)
[»] chr8 (3 HSPs)
chr8 (268-315)||(12806282-12806329)
chr8 (268-315)||(24040952-24040999)
chr8 (268-315)||(39317322-39317369)


Alignment Details
Target: chr5 (Bit Score: 251; Significance: 1e-139; HSPs: 9)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 251; E-Value: 1e-139
Query Start/End: Original strand, 18 - 332
Target Start/End: Original strand, 23166252 - 23166579
Alignment:
Q  18 atatacattatgaattttctttccatcgaaagattcattttggaaggaaaagtaaggaagtagctacatcattgttgtcaaagtgagtagaattaaacaa 117  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||    
T  23166252 atatacattatgaattttctttccatcgaaagattcattttggaaggaaaagtaaggaagtagctacatcattgttgtcaaagtcagtagaattaaacaa 23166351  T
Q  118 ttaat-------------atgtgtattgtacatcattggttttgtatannnnnnncctcctaactttaggacttgattccttgtactctcctaggttatt 204  Q
    |||||             ||||||||||||||||||||||||||||||       |||||||||||||||||||||||||||||||||| ||||||||||    
T  23166352 ttaatttttatatattatatgtgtattgtacatcattggttttgtatatttttttcctcctaactttaggacttgattccttgtactcttctaggttatt 23166451  T
Q  205 tgatcaaaggaattaaggaaaccctctattccccaaatgcttccatgtctttctggtgatagaaaaatggatggattggatgaatatgaattttgatcct 304  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||    
T  23166452 tgatcaaaggaattaaggaaaccctctattccccaaatgcttccatgtctttctggggatagaaaaatggatggattggatgaatatgaattttgatcct 23166551  T
Q  305 aatggatggatatttacgtgtgttattc 332  Q
    ||||||||||||||||||||||||||||    
T  23166552 aatggatggatatttacgtgtgttattc 23166579  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 358 - 404
Target Start/End: Original strand, 23166605 - 23166651
Alignment:
Q  358 atgaattcaatctaaatagattttggttattacatttcccacctatg 404  Q
    ||||||||||||||||||||||||||||||||| |||||||||||||    
T  23166605 atgaattcaatctaaatagattttggttattacttttcccacctatg 23166651  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #3
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 268 - 315
Target Start/End: Complemental strand, 5711835 - 5711788
Alignment:
Q  268 aaaatggatggattggatgaatatgaattttgatcctaatggatggat 315  Q
    ||||||||||||||||||| ||||| |||| |||||||||||||||||    
T  5711835 aaaatggatggattggatggatatggatttggatcctaatggatggat 5711788  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #4
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 268 - 315
Target Start/End: Original strand, 9270337 - 9270384
Alignment:
Q  268 aaaatggatggattggatgaatatgaattttgatcctaatggatggat 315  Q
    ||||||||||||||||||| |||| ||||| |||||||||||||||||    
T  9270337 aaaatggatggattggatggatataaatttggatcctaatggatggat 9270384  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #5
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 269 - 315
Target Start/End: Original strand, 10365201 - 10365247
Alignment:
Q  269 aaatggatggattggatgaatatgaattttgatcctaatggatggat 315  Q
    |||||||||||||||||| ||||| |||| |||||||||||||||||    
T  10365201 aaatggatggattggatggatatggatttggatcctaatggatggat 10365247  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #6
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 269 - 315
Target Start/End: Original strand, 38477487 - 38477533
Alignment:
Q  269 aaatggatggattggatgaatatgaattttgatcctaatggatggat 315  Q
    |||||||||||||||||| ||||| |||| |||||||||||||||||    
T  38477487 aaatggatggattggatggatatggatttggatcctaatggatggat 38477533  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #7
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 268 - 315
Target Start/End: Complemental strand, 14197750 - 14197703
Alignment:
Q  268 aaaatggatggattggatgaatatgaattttgatcctaatggatggat 315  Q
    ||||||||||||||||||| ||||| |||| |||| ||||||||||||    
T  14197750 aaaatggatggattggatggatatggatttggatcttaatggatggat 14197703  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #8
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 272 - 315
Target Start/End: Original strand, 19965002 - 19965045
Alignment:
Q  272 tggatggattggatgaatatgaattttgatcctaatggatggat 315  Q
    ||||||||||||||| |||||||||| ||| |||||||||||||    
T  19965002 tggatggattggatggatatgaatttggattctaatggatggat 19965045  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #9
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 268 - 314
Target Start/End: Complemental strand, 14463721 - 14463675
Alignment:
Q  268 aaaatggatggattggatgaatatgaattttgatcctaatggatgga 314  Q
    |||||||||||||| |||| ||||| |||| ||||||||||||||||    
T  14463721 aaaatggatggatttgatggatatggatttggatcctaatggatgga 14463675  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2 (Bit Score: 37; Significance: 0.00000000001; HSPs: 4)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 268 - 316
Target Start/End: Complemental strand, 43325415 - 43325367
Alignment:
Q  268 aaaatggatggattggatgaatatgaattttgatcctaatggatggata 316  Q
    ||||||||||||||||||||||||| |||| ||| ||||||||||||||    
T  43325415 aaaatggatggattggatgaatatggatttggattctaatggatggata 43325367  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 268 - 312
Target Start/End: Original strand, 43317705 - 43317749
Alignment:
Q  268 aaaatggatggattggatgaatatgaattttgatcctaatggatg 312  Q
    ||||||||||||||||||||||||| |||| |||| |||||||||    
T  43317705 aaaatggatggattggatgaatatggatttggatcttaatggatg 43317749  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #3
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 272 - 315
Target Start/End: Complemental strand, 5377614 - 5377571
Alignment:
Q  272 tggatggattggatgaatatgaattttgatcctaatggatggat 315  Q
    ||||||||||||||| ||||| |||| |||||||||||||||||    
T  5377614 tggatggattggatggatatggatttggatcctaatggatggat 5377571  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #4
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 268 - 315
Target Start/End: Complemental strand, 35060466 - 35060418
Alignment:
Q  268 aaaatggatggattgg-atgaatatgaattttgatcctaatggatggat 315  Q
    |||||||||||||||| ||| ||||| |||| |||||||||||||||||    
T  35060466 aaaatggatggattgggatggatatggatttggatcctaatggatggat 35060418  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0122 (Bit Score: 36; Significance: 0.00000000004; HSPs: 1)
Name: scaffold0122
Description:

Target: scaffold0122; HSP #1
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 268 - 315
Target Start/End: Original strand, 11654 - 11701
Alignment:
Q  268 aaaatggatggattggatgaatatgaattttgatcctaatggatggat 315  Q
    |||||||||||||||||||| |||| |||| |||||||||||||||||    
T  11654 aaaatggatggattggatgattatggatttggatcctaatggatggat 11701  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7 (Bit Score: 36; Significance: 0.00000000004; HSPs: 4)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 268 - 315
Target Start/End: Complemental strand, 8227173 - 8227126
Alignment:
Q  268 aaaatggatggattggatgaatatgaattttgatcctaatggatggat 315  Q
    ||||||||||||||||||| ||||| |||| |||||||||||||||||    
T  8227173 aaaatggatggattggatggatatggatttggatcctaatggatggat 8227126  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 268 - 315
Target Start/End: Complemental strand, 19756561 - 19756514
Alignment:
Q  268 aaaatggatggattggatgaatatgaattttgatcctaatggatggat 315  Q
    ||||||||||||||||||| ||||  |||| |||||||||||||||||    
T  19756561 aaaatggatggattggatgtatatagatttggatcctaatggatggat 19756514  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #3
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 267 - 316
Target Start/End: Complemental strand, 11677774 - 11677725
Alignment:
Q  267 aaaaatggatggattggatgaatatgaattttgatcctaatggatggata 316  Q
    ||||||||| ||||||||||||||||||| | |||| ||||| |||||||    
T  11677774 aaaaatggaaggattggatgaatatgaatatagatcataatgaatggata 11677725  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #4
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 268 - 316
Target Start/End: Original strand, 9626466 - 9626514
Alignment:
Q  268 aaaatggatggattggatgaatatgaattttgatcctaatggatggata 316  Q
    ||||||||||||||||||| ||||| |||| |||| |||||||| ||||    
T  9626466 aaaatggatggattggatggatatggatttggatcttaatggattgata 9626514  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6 (Bit Score: 36; Significance: 0.00000000004; HSPs: 4)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 268 - 315
Target Start/End: Complemental strand, 19686680 - 19686633
Alignment:
Q  268 aaaatggatggattggatgaatatgaattttgatcctaatggatggat 315  Q
    ||||| ||||||||||||| |||||||||| |||||||||||||||||    
T  19686680 aaaatagatggattggatggatatgaatttggatcctaatggatggat 19686633  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #2
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 268 - 315
Target Start/End: Complemental strand, 26860265 - 26860218
Alignment:
Q  268 aaaatggatggattggatgaatatgaattttgatcctaatggatggat 315  Q
    ||||||||||||||||||| ||||| |||| ||||||| |||||||||    
T  26860265 aaaatggatggattggatggatatggatttggatcctagtggatggat 26860218  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #3
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 268 - 315
Target Start/End: Original strand, 29208377 - 29208424
Alignment:
Q  268 aaaatggatggattggatgaatatgaattttgatcctaatggatggat 315  Q
    |||||||||||||| |||| ||||| |||| |||||||||||||||||    
T  29208377 aaaatggatggattagatggatatggatttagatcctaatggatggat 29208424  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #4
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 272 - 316
Target Start/End: Original strand, 15917644 - 15917688
Alignment:
Q  272 tggatggattggatgaatatgaattttgatcctaatggatggata 316  Q
    ||||||||||||||| |||||||||| ||||  ||||||||||||    
T  15917644 tggatggattggatggatatgaatttggatctgaatggatggata 15917688  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 36; Significance: 0.00000000004; HSPs: 4)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 268 - 315
Target Start/End: Complemental strand, 43366273 - 43366226
Alignment:
Q  268 aaaatggatggattggatgaatatgaattttgatcctaatggatggat 315  Q
    ||||||||||||||||||| |||||||||| |||| ||||||||||||    
T  43366273 aaaatggatggattggatggatatgaatttggatcataatggatggat 43366226  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 268 - 314
Target Start/End: Original strand, 15510664 - 15510710
Alignment:
Q  268 aaaatggatggattggatgaatatgaattttgatcctaatggatgga 314  Q
    ||||||||||||||||||| ||||| |||| ||||||||||||||||    
T  15510664 aaaatggatggattggatggatatggatttggatcctaatggatgga 15510710  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #3
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 268 - 311
Target Start/End: Complemental strand, 24912645 - 24912602
Alignment:
Q  268 aaaatggatggattggatgaatatgaattttgatcctaatggat 311  Q
    ||||||||||||||||||| ||||| |||| |||||||||||||    
T  24912645 aaaatggatggattggatggatatggatttggatcctaatggat 24912602  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #4
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 272 - 315
Target Start/End: Original strand, 32311608 - 32311651
Alignment:
Q  272 tggatggattggatgaatatgaattttgatcctaatggatggat 315  Q
    ||||||||||||||| ||||| |||| |||||||||||||||||    
T  32311608 tggatggattggatggatatggatttggatcctaatggatggat 32311651  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 36; Significance: 0.00000000004; HSPs: 4)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 268 - 315
Target Start/End: Complemental strand, 24029864 - 24029817
Alignment:
Q  268 aaaatggatggattggatgaatatgaattttgatcctaatggatggat 315  Q
    ||||||||||||||||||| ||||| |||| |||||||||||||||||    
T  24029864 aaaatggatggattggatggatatggatttggatcctaatggatggat 24029817  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 268 - 315
Target Start/End: Complemental strand, 45931698 - 45931651
Alignment:
Q  268 aaaatggatggattggatgaatatgaattttgatcctaatggatggat 315  Q
    ||||||||||||||||||| ||||| |||| |||||||||||||||||    
T  45931698 aaaatggatggattggatggatatggatttggatcctaatggatggat 45931651  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #3
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 269 - 315
Target Start/End: Original strand, 46239898 - 46239944
Alignment:
Q  269 aaatggatggattggatgaatatgaattttgatcctaatggatggat 315  Q
    ||||||||| |||||||| ||||| |||| |||||||||||||||||    
T  46239898 aaatggatgaattggatggatatggatttggatcctaatggatggat 46239944  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #4
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 268 - 313
Target Start/End: Complemental strand, 9154576 - 9154531
Alignment:
Q  268 aaaatggatggattggatgaatatgaattttgatcctaatggatgg 313  Q
    ||||||||||||||| ||| ||||| |||| |||||||||||||||    
T  9154576 aaaatggatggattgaatggatatggatttggatcctaatggatgg 9154531  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 35; Significance: 0.0000000002; HSPs: 8)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 268 - 314
Target Start/End: Original strand, 54452030 - 54452076
Alignment:
Q  268 aaaatggatggattggatgaatatgaattttgatcctaatggatgga 314  Q
    ||||||||||||||||||| ||||| |||| ||||||||||||||||    
T  54452030 aaaatggatggattggatggatatggatttggatcctaatggatgga 54452076  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 272 - 315
Target Start/End: Original strand, 5609544 - 5609587
Alignment:
Q  272 tggatggattggatgaatatgaattttgatcctaatggatggat 315  Q
    ||||||||||||||| ||||| |||| |||||||||||||||||    
T  5609544 tggatggattggatggatatggatttggatcctaatggatggat 5609587  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #3
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 268 - 315
Target Start/End: Original strand, 11673961 - 11674008
Alignment:
Q  268 aaaatggatggattggatgaatatgaattttgatcctaatggatggat 315  Q
    ||||||||||||||||||| ||||  |||| |||||||||||||||||    
T  11673961 aaaatggatggattggatggatatagatttggatcctaatggatggat 11674008  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #4
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 268 - 315
Target Start/End: Complemental strand, 24703342 - 24703295
Alignment:
Q  268 aaaatggatggattggatgaatatgaattttgatcctaatggatggat 315  Q
    |||||||||||||||||||  ||||||||| |||| ||||||||||||    
T  24703342 aaaatggatggattggatggttatgaatttggatcttaatggatggat 24703295  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #5
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 269 - 315
Target Start/End: Original strand, 418407 - 418453
Alignment:
Q  269 aaatggatggattggatgaatatgaattttgatcctaatggatggat 315  Q
    |||||||| ||||||||| ||||| |||| |||||||||||||||||    
T  418407 aaatggattgattggatggatatggatttggatcctaatggatggat 418453  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #6
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 274 - 315
Target Start/End: Original strand, 21095458 - 21095499
Alignment:
Q  274 gatggattggatgaatatgaattttgatcctaatggatggat 315  Q
    |||||||||||||||||||||||| |||| |||| |||||||    
T  21095458 gatggattggatgaatatgaatttagatcataatagatggat 21095499  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #7
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 270 - 315
Target Start/End: Complemental strand, 30819993 - 30819948
Alignment:
Q  270 aatggatggattggatgaatatgaattttgatcctaatggatggat 315  Q
    |||||||| |||||||| ||||| |||| |||||||||||||||||    
T  30819993 aatggatgaattggatggatatggatttggatcctaatggatggat 30819948  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #8
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 268 - 316
Target Start/End: Complemental strand, 13610780 - 13610732
Alignment:
Q  268 aaaatggatggattggatgaatatgaattttgatcctaatggatggata 316  Q
    ||||||||||||||||||| ||||| |||| |||| |||||||| ||||    
T  13610780 aaaatggatggattggatggatatggatttggatcttaatggattgata 13610732  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8 (Bit Score: 32; Significance: 0.000000009; HSPs: 3)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 268 - 315
Target Start/End: Original strand, 12806282 - 12806329
Alignment:
Q  268 aaaatggatggattggatgaatatgaattttgatcctaatggatggat 315  Q
    |||||||||||||| |||| ||||| |||| |||||||||||||||||    
T  12806282 aaaatggatggatttgatggatatggatttggatcctaatggatggat 12806329  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 268 - 315
Target Start/End: Original strand, 24040952 - 24040999
Alignment:
Q  268 aaaatggatggattggatgaatatgaattttgatcctaatggatggat 315  Q
    ||||||||||||||||||| |||||||||| |||| ||||| ||||||    
T  24040952 aaaatggatggattggatggatatgaatttggatcttaatgaatggat 24040999  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #3
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 268 - 315
Target Start/End: Original strand, 39317322 - 39317369
Alignment:
Q  268 aaaatggatggattggatgaatatgaattttgatcctaatggatggat 315  Q
    ||||||||||||||||||| |||||||||| |||  ||||||||||||    
T  39317322 aaaatggatggattggatggatatgaatttggattttaatggatggat 39317369  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University