View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12522_low_10 (Length: 266)
Name: NF12522_low_10
Description: NF12522
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12522_low_10 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 177; Significance: 2e-95; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 177; E-Value: 2e-95
Query Start/End: Original strand, 15 - 250
Target Start/End: Complemental strand, 36599495 - 36599260
Alignment:
| Q |
15 |
ctgtatgacgtcgttccgacaaggtgtcctctgtattacttatgctgaaccgagttcctggactgctcacaaggcagtgacaaagcacctgattatggga |
114 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||| |||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
36599495 |
ctgtatgacgtcgttccgacacggtgtcctctgtattacttatgct-aaccgagttcctggactgctcacaaggcagcaacaaagcacctgattatggga |
36599397 |
T |
 |
| Q |
115 |
aggttgtagagatcgccatgtttatggcaatcttgagacgatga-ggtaatatgattgcaaactccaccgtgaagaataatgataagctgccatacaagg |
213 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| | | || |||||||||||||||||||||||||||||||||| ||||||||||||||| |||| |
|
|
| T |
36599396 |
aggttgtagagatcgccatgtttatggcaatcttgaaataacgatggtaatatgattgcaaactccaccgtgaagaatagtgataagctgccatataagg |
36599297 |
T |
 |
| Q |
214 |
ttgttgcataaacactgcacgaaaaaagaaaatattg |
250 |
Q |
| |
|
|||||||||||||||||||| || ||||||||||||| |
|
|
| T |
36599296 |
ttgttgcataaacactgcacaaacaaagaaaatattg |
36599260 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University