View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12522_low_14 (Length: 247)
Name: NF12522_low_14
Description: NF12522
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12522_low_14 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 184; Significance: 1e-99; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 184; E-Value: 1e-99
Query Start/End: Original strand, 12 - 228
Target Start/End: Complemental strand, 52182426 - 52182206
Alignment:
| Q |
12 |
cgttcactgtgctgcataaccgaaaagaaaatatacaagatagaaatataattgagaaagattagtggtagtagagcacgtaattaaaggcactagtgca |
111 |
Q |
| |
|
||||| ||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52182426 |
cgttctctgtgctgcgcaaccgaaaagaaaatatacaagatagaaatataattgagaaagattagtggtagtagagcacgtaattaaaggcactagtgca |
52182327 |
T |
 |
| Q |
112 |
ctaagcattgagggggcgtttaatttttcaggaactttacttgaaccacgttcttgcaattttaacccgtgatat----attccatcttttgcatgctca |
207 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |||||||| |||||||||||| |
|
|
| T |
52182326 |
ctaagcattgagggggcgtttaatttttcaggaactttacttgacccacgttcttgcaattttaacccgtgatatattaattccatcctttgcatgctca |
52182227 |
T |
 |
| Q |
208 |
ttcttgcattcatcttgctcc |
228 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
52182226 |
ttcttgcattcatcttgctcc |
52182206 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University