View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12522_low_19 (Length: 235)
Name: NF12522_low_19
Description: NF12522
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12522_low_19 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 193; Significance: 1e-105; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 193; E-Value: 1e-105
Query Start/End: Original strand, 20 - 220
Target Start/End: Original strand, 28035735 - 28035935
Alignment:
| Q |
20 |
atttccatcaaagccattgctgaataatgttgcacatcatctgtacccttttccaacaaaaccgcgaaacacaaaagagctcttgattctgtaattgtat |
119 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
28035735 |
atttccatcaaagccattgctgaataatgttgcacatcatcagtacccttttccaacaaaaccgcaaaacacaaaagagctcttgattctgtaattgtat |
28035834 |
T |
 |
| Q |
120 |
gacaaatagtaacatttcttctacacaattgccataaagctctagctgccattgctttcatttgtgcctttgtttcaggatcttcaaattctctcccttt |
219 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28035835 |
gacaaatagtaacatttcttctacacaattgccataaagctctagctgccattgctttcatttgtgcctttgtttcaggatcttcaaattctctcccttt |
28035934 |
T |
 |
| Q |
220 |
g |
220 |
Q |
| |
|
| |
|
|
| T |
28035935 |
g |
28035935 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University