View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12522_low_21 (Length: 213)
Name: NF12522_low_21
Description: NF12522
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12522_low_21 |
 | |
|
| [»] scaffold0038 (1 HSPs) |
| | |
|
Alignment Details
Target: chr6 (Bit Score: 61; Significance: 2e-26; HSPs: 4)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 61; E-Value: 2e-26
Query Start/End: Original strand, 15 - 79
Target Start/End: Original strand, 26812134 - 26812198
Alignment:
| Q |
15 |
cagagatttccaaaaagatcaaccgtggtcttttagaagttgctgatcaccctgttgtgggactt |
79 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
26812134 |
cagagatttccaaaaagatcaaccgtggtcttttagaagttgctgatcaccctattgtgggactt |
26812198 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 15 - 79
Target Start/End: Original strand, 26618246 - 26618310
Alignment:
| Q |
15 |
cagagatttccaaaaagatcaaccgtggtcttttagaagttgctgatcaccctgttgtgggactt |
79 |
Q |
| |
|
||||||||| || |||||||| ||||||||||||||||||||||||||| ||||| |||||| |
|
|
| T |
26618246 |
cagagatttggaacaagatcaattgtggtcttttagaagttgctgatcacctagttgttggactt |
26618310 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 15 - 79
Target Start/End: Original strand, 26724174 - 26724238
Alignment:
| Q |
15 |
cagagatttccaaaaagatcaaccgtggtcttttagaagttgctgatcaccctgttgtgggactt |
79 |
Q |
| |
|
||||||||| || |||||||| ||||||||||||||||||||||||||| ||||| |||||| |
|
|
| T |
26724174 |
cagagatttggaacaagatcaattgtggtcttttagaagttgctgatcacctagttgttggactt |
26724238 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #4
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 149 - 182
Target Start/End: Complemental strand, 28242426 - 28242393
Alignment:
| Q |
149 |
gaaatatcagtttggtagatgagattaaatatcg |
182 |
Q |
| |
|
||||| |||||||||||||||||||||||||||| |
|
|
| T |
28242426 |
gaaatgtcagtttggtagatgagattaaatatcg |
28242393 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0038 (Bit Score: 30; Significance: 0.00000007; HSPs: 1)
Name: scaffold0038
Description:
Target: scaffold0038; HSP #1
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 149 - 182
Target Start/End: Complemental strand, 42588 - 42555
Alignment:
| Q |
149 |
gaaatatcagtttggtagatgagattaaatatcg |
182 |
Q |
| |
|
||||| |||||||||||||||||||||||||||| |
|
|
| T |
42588 |
gaaatgtcagtttggtagatgagattaaatatcg |
42555 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University