View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12522_low_4 (Length: 414)
Name: NF12522_low_4
Description: NF12522
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12522_low_4 |
 |  |
|
| [»] scaffold0122 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr5 (Bit Score: 251; Significance: 1e-139; HSPs: 9)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 251; E-Value: 1e-139
Query Start/End: Original strand, 18 - 332
Target Start/End: Original strand, 23166252 - 23166579
Alignment:
| Q |
18 |
atatacattatgaattttctttccatcgaaagattcattttggaaggaaaagtaaggaagtagctacatcattgttgtcaaagtgagtagaattaaacaa |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
23166252 |
atatacattatgaattttctttccatcgaaagattcattttggaaggaaaagtaaggaagtagctacatcattgttgtcaaagtcagtagaattaaacaa |
23166351 |
T |
 |
| Q |
118 |
ttaat-------------atgtgtattgtacatcattggttttgtatannnnnnncctcctaactttaggacttgattccttgtactctcctaggttatt |
204 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
23166352 |
ttaatttttatatattatatgtgtattgtacatcattggttttgtatatttttttcctcctaactttaggacttgattccttgtactcttctaggttatt |
23166451 |
T |
 |
| Q |
205 |
tgatcaaaggaattaaggaaaccctctattccccaaatgcttccatgtctttctggtgatagaaaaatggatggattggatgaatatgaattttgatcct |
304 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23166452 |
tgatcaaaggaattaaggaaaccctctattccccaaatgcttccatgtctttctggggatagaaaaatggatggattggatgaatatgaattttgatcct |
23166551 |
T |
 |
| Q |
305 |
aatggatggatatttacgtgtgttattc |
332 |
Q |
| |
|
|||||||||||||||||||||||||||| |
|
|
| T |
23166552 |
aatggatggatatttacgtgtgttattc |
23166579 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 358 - 404
Target Start/End: Original strand, 23166605 - 23166651
Alignment:
| Q |
358 |
atgaattcaatctaaatagattttggttattacatttcccacctatg |
404 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
23166605 |
atgaattcaatctaaatagattttggttattacttttcccacctatg |
23166651 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 268 - 315
Target Start/End: Complemental strand, 5711835 - 5711788
Alignment:
| Q |
268 |
aaaatggatggattggatgaatatgaattttgatcctaatggatggat |
315 |
Q |
| |
|
||||||||||||||||||| ||||| |||| ||||||||||||||||| |
|
|
| T |
5711835 |
aaaatggatggattggatggatatggatttggatcctaatggatggat |
5711788 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #4
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 268 - 315
Target Start/End: Original strand, 9270337 - 9270384
Alignment:
| Q |
268 |
aaaatggatggattggatgaatatgaattttgatcctaatggatggat |
315 |
Q |
| |
|
||||||||||||||||||| |||| ||||| ||||||||||||||||| |
|
|
| T |
9270337 |
aaaatggatggattggatggatataaatttggatcctaatggatggat |
9270384 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #5
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 269 - 315
Target Start/End: Original strand, 10365201 - 10365247
Alignment:
| Q |
269 |
aaatggatggattggatgaatatgaattttgatcctaatggatggat |
315 |
Q |
| |
|
|||||||||||||||||| ||||| |||| ||||||||||||||||| |
|
|
| T |
10365201 |
aaatggatggattggatggatatggatttggatcctaatggatggat |
10365247 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #6
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 269 - 315
Target Start/End: Original strand, 38477487 - 38477533
Alignment:
| Q |
269 |
aaatggatggattggatgaatatgaattttgatcctaatggatggat |
315 |
Q |
| |
|
|||||||||||||||||| ||||| |||| ||||||||||||||||| |
|
|
| T |
38477487 |
aaatggatggattggatggatatggatttggatcctaatggatggat |
38477533 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #7
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 268 - 315
Target Start/End: Complemental strand, 14197750 - 14197703
Alignment:
| Q |
268 |
aaaatggatggattggatgaatatgaattttgatcctaatggatggat |
315 |
Q |
| |
|
||||||||||||||||||| ||||| |||| |||| |||||||||||| |
|
|
| T |
14197750 |
aaaatggatggattggatggatatggatttggatcttaatggatggat |
14197703 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #8
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 272 - 315
Target Start/End: Original strand, 19965002 - 19965045
Alignment:
| Q |
272 |
tggatggattggatgaatatgaattttgatcctaatggatggat |
315 |
Q |
| |
|
||||||||||||||| |||||||||| ||| ||||||||||||| |
|
|
| T |
19965002 |
tggatggattggatggatatgaatttggattctaatggatggat |
19965045 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #9
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 268 - 314
Target Start/End: Complemental strand, 14463721 - 14463675
Alignment:
| Q |
268 |
aaaatggatggattggatgaatatgaattttgatcctaatggatgga |
314 |
Q |
| |
|
|||||||||||||| |||| ||||| |||| |||||||||||||||| |
|
|
| T |
14463721 |
aaaatggatggatttgatggatatggatttggatcctaatggatgga |
14463675 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 37; Significance: 0.00000000001; HSPs: 4)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 268 - 316
Target Start/End: Complemental strand, 43325415 - 43325367
Alignment:
| Q |
268 |
aaaatggatggattggatgaatatgaattttgatcctaatggatggata |
316 |
Q |
| |
|
||||||||||||||||||||||||| |||| ||| |||||||||||||| |
|
|
| T |
43325415 |
aaaatggatggattggatgaatatggatttggattctaatggatggata |
43325367 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 268 - 312
Target Start/End: Original strand, 43317705 - 43317749
Alignment:
| Q |
268 |
aaaatggatggattggatgaatatgaattttgatcctaatggatg |
312 |
Q |
| |
|
||||||||||||||||||||||||| |||| |||| ||||||||| |
|
|
| T |
43317705 |
aaaatggatggattggatgaatatggatttggatcttaatggatg |
43317749 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 272 - 315
Target Start/End: Complemental strand, 5377614 - 5377571
Alignment:
| Q |
272 |
tggatggattggatgaatatgaattttgatcctaatggatggat |
315 |
Q |
| |
|
||||||||||||||| ||||| |||| ||||||||||||||||| |
|
|
| T |
5377614 |
tggatggattggatggatatggatttggatcctaatggatggat |
5377571 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #4
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 268 - 315
Target Start/End: Complemental strand, 35060466 - 35060418
Alignment:
| Q |
268 |
aaaatggatggattgg-atgaatatgaattttgatcctaatggatggat |
315 |
Q |
| |
|
|||||||||||||||| ||| ||||| |||| ||||||||||||||||| |
|
|
| T |
35060466 |
aaaatggatggattgggatggatatggatttggatcctaatggatggat |
35060418 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0122 (Bit Score: 36; Significance: 0.00000000004; HSPs: 1)
Name: scaffold0122
Description:
Target: scaffold0122; HSP #1
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 268 - 315
Target Start/End: Original strand, 11654 - 11701
Alignment:
| Q |
268 |
aaaatggatggattggatgaatatgaattttgatcctaatggatggat |
315 |
Q |
| |
|
|||||||||||||||||||| |||| |||| ||||||||||||||||| |
|
|
| T |
11654 |
aaaatggatggattggatgattatggatttggatcctaatggatggat |
11701 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 36; Significance: 0.00000000004; HSPs: 4)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 268 - 315
Target Start/End: Complemental strand, 8227173 - 8227126
Alignment:
| Q |
268 |
aaaatggatggattggatgaatatgaattttgatcctaatggatggat |
315 |
Q |
| |
|
||||||||||||||||||| ||||| |||| ||||||||||||||||| |
|
|
| T |
8227173 |
aaaatggatggattggatggatatggatttggatcctaatggatggat |
8227126 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 268 - 315
Target Start/End: Complemental strand, 19756561 - 19756514
Alignment:
| Q |
268 |
aaaatggatggattggatgaatatgaattttgatcctaatggatggat |
315 |
Q |
| |
|
||||||||||||||||||| |||| |||| ||||||||||||||||| |
|
|
| T |
19756561 |
aaaatggatggattggatgtatatagatttggatcctaatggatggat |
19756514 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 267 - 316
Target Start/End: Complemental strand, 11677774 - 11677725
Alignment:
| Q |
267 |
aaaaatggatggattggatgaatatgaattttgatcctaatggatggata |
316 |
Q |
| |
|
||||||||| ||||||||||||||||||| | |||| ||||| ||||||| |
|
|
| T |
11677774 |
aaaaatggaaggattggatgaatatgaatatagatcataatgaatggata |
11677725 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #4
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 268 - 316
Target Start/End: Original strand, 9626466 - 9626514
Alignment:
| Q |
268 |
aaaatggatggattggatgaatatgaattttgatcctaatggatggata |
316 |
Q |
| |
|
||||||||||||||||||| ||||| |||| |||| |||||||| |||| |
|
|
| T |
9626466 |
aaaatggatggattggatggatatggatttggatcttaatggattgata |
9626514 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 36; Significance: 0.00000000004; HSPs: 4)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 268 - 315
Target Start/End: Complemental strand, 19686680 - 19686633
Alignment:
| Q |
268 |
aaaatggatggattggatgaatatgaattttgatcctaatggatggat |
315 |
Q |
| |
|
||||| ||||||||||||| |||||||||| ||||||||||||||||| |
|
|
| T |
19686680 |
aaaatagatggattggatggatatgaatttggatcctaatggatggat |
19686633 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 268 - 315
Target Start/End: Complemental strand, 26860265 - 26860218
Alignment:
| Q |
268 |
aaaatggatggattggatgaatatgaattttgatcctaatggatggat |
315 |
Q |
| |
|
||||||||||||||||||| ||||| |||| ||||||| ||||||||| |
|
|
| T |
26860265 |
aaaatggatggattggatggatatggatttggatcctagtggatggat |
26860218 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 268 - 315
Target Start/End: Original strand, 29208377 - 29208424
Alignment:
| Q |
268 |
aaaatggatggattggatgaatatgaattttgatcctaatggatggat |
315 |
Q |
| |
|
|||||||||||||| |||| ||||| |||| ||||||||||||||||| |
|
|
| T |
29208377 |
aaaatggatggattagatggatatggatttagatcctaatggatggat |
29208424 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #4
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 272 - 316
Target Start/End: Original strand, 15917644 - 15917688
Alignment:
| Q |
272 |
tggatggattggatgaatatgaattttgatcctaatggatggata |
316 |
Q |
| |
|
||||||||||||||| |||||||||| |||| |||||||||||| |
|
|
| T |
15917644 |
tggatggattggatggatatgaatttggatctgaatggatggata |
15917688 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 36; Significance: 0.00000000004; HSPs: 4)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 268 - 315
Target Start/End: Complemental strand, 43366273 - 43366226
Alignment:
| Q |
268 |
aaaatggatggattggatgaatatgaattttgatcctaatggatggat |
315 |
Q |
| |
|
||||||||||||||||||| |||||||||| |||| |||||||||||| |
|
|
| T |
43366273 |
aaaatggatggattggatggatatgaatttggatcataatggatggat |
43366226 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 268 - 314
Target Start/End: Original strand, 15510664 - 15510710
Alignment:
| Q |
268 |
aaaatggatggattggatgaatatgaattttgatcctaatggatgga |
314 |
Q |
| |
|
||||||||||||||||||| ||||| |||| |||||||||||||||| |
|
|
| T |
15510664 |
aaaatggatggattggatggatatggatttggatcctaatggatgga |
15510710 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 268 - 311
Target Start/End: Complemental strand, 24912645 - 24912602
Alignment:
| Q |
268 |
aaaatggatggattggatgaatatgaattttgatcctaatggat |
311 |
Q |
| |
|
||||||||||||||||||| ||||| |||| ||||||||||||| |
|
|
| T |
24912645 |
aaaatggatggattggatggatatggatttggatcctaatggat |
24912602 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #4
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 272 - 315
Target Start/End: Original strand, 32311608 - 32311651
Alignment:
| Q |
272 |
tggatggattggatgaatatgaattttgatcctaatggatggat |
315 |
Q |
| |
|
||||||||||||||| ||||| |||| ||||||||||||||||| |
|
|
| T |
32311608 |
tggatggattggatggatatggatttggatcctaatggatggat |
32311651 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 36; Significance: 0.00000000004; HSPs: 4)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 268 - 315
Target Start/End: Complemental strand, 24029864 - 24029817
Alignment:
| Q |
268 |
aaaatggatggattggatgaatatgaattttgatcctaatggatggat |
315 |
Q |
| |
|
||||||||||||||||||| ||||| |||| ||||||||||||||||| |
|
|
| T |
24029864 |
aaaatggatggattggatggatatggatttggatcctaatggatggat |
24029817 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 268 - 315
Target Start/End: Complemental strand, 45931698 - 45931651
Alignment:
| Q |
268 |
aaaatggatggattggatgaatatgaattttgatcctaatggatggat |
315 |
Q |
| |
|
||||||||||||||||||| ||||| |||| ||||||||||||||||| |
|
|
| T |
45931698 |
aaaatggatggattggatggatatggatttggatcctaatggatggat |
45931651 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 269 - 315
Target Start/End: Original strand, 46239898 - 46239944
Alignment:
| Q |
269 |
aaatggatggattggatgaatatgaattttgatcctaatggatggat |
315 |
Q |
| |
|
||||||||| |||||||| ||||| |||| ||||||||||||||||| |
|
|
| T |
46239898 |
aaatggatgaattggatggatatggatttggatcctaatggatggat |
46239944 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #4
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 268 - 313
Target Start/End: Complemental strand, 9154576 - 9154531
Alignment:
| Q |
268 |
aaaatggatggattggatgaatatgaattttgatcctaatggatgg |
313 |
Q |
| |
|
||||||||||||||| ||| ||||| |||| ||||||||||||||| |
|
|
| T |
9154576 |
aaaatggatggattgaatggatatggatttggatcctaatggatgg |
9154531 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 35; Significance: 0.0000000002; HSPs: 8)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 268 - 314
Target Start/End: Original strand, 54452030 - 54452076
Alignment:
| Q |
268 |
aaaatggatggattggatgaatatgaattttgatcctaatggatgga |
314 |
Q |
| |
|
||||||||||||||||||| ||||| |||| |||||||||||||||| |
|
|
| T |
54452030 |
aaaatggatggattggatggatatggatttggatcctaatggatgga |
54452076 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 272 - 315
Target Start/End: Original strand, 5609544 - 5609587
Alignment:
| Q |
272 |
tggatggattggatgaatatgaattttgatcctaatggatggat |
315 |
Q |
| |
|
||||||||||||||| ||||| |||| ||||||||||||||||| |
|
|
| T |
5609544 |
tggatggattggatggatatggatttggatcctaatggatggat |
5609587 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 268 - 315
Target Start/End: Original strand, 11673961 - 11674008
Alignment:
| Q |
268 |
aaaatggatggattggatgaatatgaattttgatcctaatggatggat |
315 |
Q |
| |
|
||||||||||||||||||| |||| |||| ||||||||||||||||| |
|
|
| T |
11673961 |
aaaatggatggattggatggatatagatttggatcctaatggatggat |
11674008 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #4
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 268 - 315
Target Start/End: Complemental strand, 24703342 - 24703295
Alignment:
| Q |
268 |
aaaatggatggattggatgaatatgaattttgatcctaatggatggat |
315 |
Q |
| |
|
||||||||||||||||||| ||||||||| |||| |||||||||||| |
|
|
| T |
24703342 |
aaaatggatggattggatggttatgaatttggatcttaatggatggat |
24703295 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #5
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 269 - 315
Target Start/End: Original strand, 418407 - 418453
Alignment:
| Q |
269 |
aaatggatggattggatgaatatgaattttgatcctaatggatggat |
315 |
Q |
| |
|
|||||||| ||||||||| ||||| |||| ||||||||||||||||| |
|
|
| T |
418407 |
aaatggattgattggatggatatggatttggatcctaatggatggat |
418453 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #6
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 274 - 315
Target Start/End: Original strand, 21095458 - 21095499
Alignment:
| Q |
274 |
gatggattggatgaatatgaattttgatcctaatggatggat |
315 |
Q |
| |
|
|||||||||||||||||||||||| |||| |||| ||||||| |
|
|
| T |
21095458 |
gatggattggatgaatatgaatttagatcataatagatggat |
21095499 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #7
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 270 - 315
Target Start/End: Complemental strand, 30819993 - 30819948
Alignment:
| Q |
270 |
aatggatggattggatgaatatgaattttgatcctaatggatggat |
315 |
Q |
| |
|
|||||||| |||||||| ||||| |||| ||||||||||||||||| |
|
|
| T |
30819993 |
aatggatgaattggatggatatggatttggatcctaatggatggat |
30819948 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #8
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 268 - 316
Target Start/End: Complemental strand, 13610780 - 13610732
Alignment:
| Q |
268 |
aaaatggatggattggatgaatatgaattttgatcctaatggatggata |
316 |
Q |
| |
|
||||||||||||||||||| ||||| |||| |||| |||||||| |||| |
|
|
| T |
13610780 |
aaaatggatggattggatggatatggatttggatcttaatggattgata |
13610732 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 32; Significance: 0.000000009; HSPs: 3)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 268 - 315
Target Start/End: Original strand, 12806282 - 12806329
Alignment:
| Q |
268 |
aaaatggatggattggatgaatatgaattttgatcctaatggatggat |
315 |
Q |
| |
|
|||||||||||||| |||| ||||| |||| ||||||||||||||||| |
|
|
| T |
12806282 |
aaaatggatggatttgatggatatggatttggatcctaatggatggat |
12806329 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 268 - 315
Target Start/End: Original strand, 24040952 - 24040999
Alignment:
| Q |
268 |
aaaatggatggattggatgaatatgaattttgatcctaatggatggat |
315 |
Q |
| |
|
||||||||||||||||||| |||||||||| |||| ||||| |||||| |
|
|
| T |
24040952 |
aaaatggatggattggatggatatgaatttggatcttaatgaatggat |
24040999 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 268 - 315
Target Start/End: Original strand, 39317322 - 39317369
Alignment:
| Q |
268 |
aaaatggatggattggatgaatatgaattttgatcctaatggatggat |
315 |
Q |
| |
|
||||||||||||||||||| |||||||||| ||| |||||||||||| |
|
|
| T |
39317322 |
aaaatggatggattggatggatatgaatttggattttaatggatggat |
39317369 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University