View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF12523_high_3 (Length: 517)

Name: NF12523_high_3
Description: NF12523
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF12523_high_3
NF12523_high_3
[»] chr7 (3 HSPs)
chr7 (37-404)||(43658277-43658651)
chr7 (431-501)||(43658730-43658800)
chr7 (231-388)||(23052477-23052634)
[»] chr3 (1 HSPs)
chr3 (285-388)||(31677425-31677528)
[»] chr1 (2 HSPs)
chr1 (285-388)||(3542644-3542747)
chr1 (285-388)||(5811075-5811178)
[»] chr2 (1 HSPs)
chr2 (285-385)||(6825850-6825950)
[»] chr6 (1 HSPs)
chr6 (350-379)||(17603942-17603971)
[»] chr4 (1 HSPs)
chr4 (437-501)||(34314262-34314327)


Alignment Details
Target: chr7 (Bit Score: 260; Significance: 1e-144; HSPs: 3)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 260; E-Value: 1e-144
Query Start/End: Original strand, 37 - 404
Target Start/End: Original strand, 43658277 - 43658651
Alignment:
37 ggggatttcaatgcggcgcgcagggtgaaagaaagaaggtcgactcggcgtg------acacaa-gaattttgtgccttataataattttattcaagaaa 129  Q
    |||||||||||||||| |||||||||| ||||||||||||| ||||||||||      || ||| |||||||| ||||| ||||||||||||| ||||||    
43658277 ggggatttcaatgcggtgcgcagggtggaagaaagaaggtcaactcggcgtgggggtgacgcaacgaattttgcgccttttaataattttattgaagaaa 43658376  T
130 atatgctaattcatttaccgttgtgcagtctgaggtccacatggtttaagggcgatggcgtatctatgaataggattgacagatttttgctattggagga 229  Q
    ||||||||||| |||||||||| ||| ||||||||| ||| |||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||    
43658377 atatgctaattgatttaccgttatgcggtctgaggttcacgtggtttaagggcgatggcgtatctatgaataggattgacagatttttgctatcggagga 43658476  T
230 gtggtgcttaagatggcctaatagtcttcagattggtcttcttcgtggggtttccgatcattacccgcttcagttgtcggtggatgaggaaaattggggt 329  Q
    ||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| ||||||||||||||| |||||||||||||||||||||    
43658477 gtggtgcttaagatggcctaatagtcttcagattggtcttctttgtggggtttccgatcattgcccgcttcagttgtcagtggatgaggaaaattggggt 43658576  T
330 cctcgtcctactcgtgtgtggaaatgctggcaagacatgcctggttataagcagtttgtagtcgaagtagtttta 404  Q
    |||| |||||||||||||| ||||||||||||||||||| |||||||||| ||||||||||| ||||||||||||    
43658577 cctcatcctactcgtgtgttgaaatgctggcaagacatgtctggttataaacagtttgtagttgaagtagtttta 43658651  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 59; E-Value: 9e-25
Query Start/End: Original strand, 431 - 501
Target Start/End: Original strand, 43658730 - 43658800
Alignment:
431 tgaagattttttctctcccaatgatttcaattgtgaatgtggtggttaggaagtatttcatagaatatagt 501  Q
    |||||||||||||||||||||||||||| |||||||||||||||| ||||||||||||||| |||||||||    
43658730 tgaagattttttctctcccaatgatttctattgtgaatgtggtggctaggaagtatttcattgaatatagt 43658800  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #3
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 231 - 388
Target Start/End: Original strand, 23052477 - 23052634
Alignment:
231 tggtgcttaagatggcctaatagtcttcagattggtcttcttcgtggggtttccgatcattacccgcttcagttgtcggtggatgaggaaaattggggtc 330  Q
    ||||||||||||||||| ||  | |||||||||| |||||| | ||| || || ||||| | ||| ||| ||| ||  |||||| ||||||||| ||| |    
23052477 tggtgcttaagatggccaaactgccttcagattgctcttctccatggtgtatcggatcactgccctctttagtagtttgtggataaggaaaatttgggac 23052576  T
331 ctcgtcctactcgtgtgtggaaatgctggcaagacatgcctggttataagcagtttgt 388  Q
    | |||||  ||||  ||| ||| || |||||||| |||||||||||||||||||||||    
23052577 cgcgtccgtctcgaatgttgaagtgttggcaagagatgcctggttataagcagtttgt 23052634  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 40; Significance: 0.0000000000002; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 285 - 388
Target Start/End: Complemental strand, 31677528 - 31677425
Alignment:
285 gatcattacccgcttcagttgtcggtggatgaggaaaattggggtcctcgtcctactcgtgtgtggaaatgctggcaagacatgcctggttataagcagt 384  Q
    |||||||  ||||||||||||||||| ||||||||||| ||||| || ||||| ||| |  ||  |||||| |||||||||||||| ||||| || ||||    
31677528 gatcattgtccgcttcagttgtcggttgatgaggaaaactggggaccgcgtccaactagaatgctgaaatgttggcaagacatgccgggttacaaacagt 31677429  T
385 ttgt 388  Q
    ||||    
31677428 ttgt 31677425  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 40; Significance: 0.0000000000002; HSPs: 2)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 285 - 388
Target Start/End: Original strand, 3542644 - 3542747
Alignment:
285 gatcattacccgcttcagttgtcggtggatgaggaaaattggggtcctcgtcctactcgtgtgtggaaatgctggcaagacatgcctggttataagcagt 384  Q
    |||||||  ||||||||| ||||||| ||||||||||||||||| || ||||| ||| |  ||  |||||| |||||||| ||||| |||||||| ||||    
3542644 gatcattgtccgcttcagctgtcggttgatgaggaaaattggggaccgcgtccaactagaatgctgaaatgttggcaagatatgccgggttataaacagt 3542743  T
385 ttgt 388  Q
    ||||    
3542744 ttgt 3542747  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 285 - 388
Target Start/End: Complemental strand, 5811178 - 5811075
Alignment:
285 gatcattacccgcttcagttgtcggtggatgaggaaaattggggtcctcgtcctactcgtgtgtggaaatgctggcaagacatgcctggttataagcagt 384  Q
    |||||||  ||||||||||| || ||||||||| |||||||||| || |||||  || |  |||  ||||| ||||||||  ||||||| ||||||||||    
5811178 gatcattgtccgcttcagttatctgtggatgagaaaaattggggaccccgtccgtctagaatgttaaaatgttggcaagatttgcctggctataagcagt 5811079  T
385 ttgt 388  Q
    ||||    
5811078 ttgt 5811075  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2 (Bit Score: 33; Significance: 0.000000003; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 285 - 385
Target Start/End: Complemental strand, 6825950 - 6825850
Alignment:
285 gatcattacccgcttcagttgtcggtggatgaggaaaattggggtcctcgtcctactcgtgtgtggaaatgctggcaagacatgcctggttataagcagt 384  Q
    ||||||| |||| | |||||||| |||||||||||||||||||| || |||||  || |  ||  |||||| |||||||| ||| | |||||||||||||    
6825950 gatcattgcccgttgcagttgtctgtggatgaggaaaattggggaccccgtccgtctagaatgctgaaatgttggcaagagatgtcgggttataagcagt 6825851  T
385 t 385  Q
    |    
6825850 t 6825850  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6 (Bit Score: 30; Significance: 0.0000002; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 350 - 379
Target Start/End: Original strand, 17603942 - 17603971
Alignment:
350 gaaatgctggcaagacatgcctggttataa 379  Q
    ||||||||||||||||||||||||||||||    
17603942 gaaatgctggcaagacatgcctggttataa 17603971  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 30; Significance: 0.0000002; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 437 - 501
Target Start/End: Complemental strand, 34314327 - 34314262
Alignment:
437 ttttttctctcccaatgatttcaattgtgaatgtggtggt-taggaagtatttcatagaatatagt 501  Q
    |||||| ||||||||||| ||||| || |||||| |||   |||||||||||||||||||||||||    
34314327 ttttttttctcccaatgacttcaactgcgaatgtcgtgtactaggaagtatttcatagaatatagt 34314262  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University