View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12523_high_8 (Length: 357)
Name: NF12523_high_8
Description: NF12523
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12523_high_8 |
 | |
|
| [»] chr7 (2 HSPs) |
| |
|
Alignment Details
Target: chr7 (Bit Score: 277; Significance: 1e-155; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 277; E-Value: 1e-155
Query Start/End: Original strand, 22 - 357
Target Start/End: Original strand, 41757190 - 41757523
Alignment:
| Q |
22 |
ccactgagacgttaaaaaccgtgatgttgcgacctgcattgtggtttacacaannnnnnnnnnnnnnnngctgcttctctttaatttccaggggccagag |
121 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| | ||||||||||||||||||||||||||||||| |
|
|
| T |
41757190 |
ccactgagacgttaaaaaccgtgatgttgcgacctgcattgtggtttaca--attttttcaaactttttgctgcttctctttaatttccaggggccagag |
41757287 |
T |
|
| Q |
122 |
acatcaaagtcagttccaaacttgtacaaaaattcaatccgagcgctttgcaatgcgaacacatcagagggattcaagcctgcaaaggatgtatctattc |
221 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41757288 |
acatcaaagtcagttccaaacttgtacaaaaattcaatccgagcgctttgcaatgcgaacacatcagagggattcaagcctgcaaaggatgtatctattc |
41757387 |
T |
|
| Q |
222 |
cagaaaccaatcttcaaaccggtacaatacatggtattgttggcgggccatcaccatctaagcgatcagttttggctttcttcgccggtggggttcatgg |
321 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41757388 |
cagaaaccaatcttcaaaccggtacaatacatggtattgttggcgggccatcaccatctaagcgatcagttttggctttcttcgccggtggggttcatgg |
41757487 |
T |
|
| Q |
322 |
gcccgttaggcctgttctacttgaacattgggaaca |
357 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
41757488 |
gcccgttaggcctgttctacttgaacattgggaaca |
41757523 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 102; E-Value: 1e-50
Query Start/End: Original strand, 132 - 357
Target Start/End: Original strand, 41765381 - 41765606
Alignment:
| Q |
132 |
cagttccaaacttgtacaaaaattcaatccgagcgctttgcaatgcgaacacatcagagggattcaagcctgcaaaggatgtatctattccagaaaccaa |
231 |
Q |
| |
|
||||||||||||||||||| ||||| || || ||| |||||||||| ||||| ||||||||||||||||| | ||| ||||||||||||||||||| ||| |
|
|
| T |
41765381 |
cagttccaaacttgtacaagaattcgattcgtgcgttttgcaatgccaacacctcagagggattcaagccagtaaaagatgtatctattccagaaatcaa |
41765480 |
T |
|
| Q |
232 |
tcttcaaaccggtacaatacatggtattgttggcgggccatcaccatctaagcgatcagttttggctttcttcgccggtggggttcatgggcccgttagg |
331 |
Q |
| |
|
| ||| |||||| | ||| ||| | || ||||||| ||||||||||||||| ||||| |||||||||||||||| |||||| |||||||| ||||| |
|
|
| T |
41765481 |
tgttcgaaccggcataattgatgatcttcttggcggaccatcaccatctaagagatcaattttggctttcttcgctggtgggcttcatggggatattagg |
41765580 |
T |
|
| Q |
332 |
cctgttctacttgaacattgggaaca |
357 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
41765581 |
aatgttctacttgaacattgggaaca |
41765606 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University